Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000431.1

Orthogroup ID

OG0007243

Physical Location & Seq

Genomic Coordinates Reverse (-)

183747 .. 184340

Gene Structure 594 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000431.1_g000035.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 594 bp

atgggcattccattagagctttcttctcttagctgtgaactgagaatcatacaagccaaaaacatagagtacatcaagaccacgggaaacctgttcgtcagatattatttttctgcaggggacagcagaagaattaggctgaacactcgagaaatcttcaccaagtctgaccacatctggaacgagtctatttccttggagtgtaatggaagcgacagctttgtgcgagaaactgtggtttttgagctccggtggaggaataccgtgcctgtttttggaagaattgggggatcacaagtactgggcagggcagaggtcccatggaaagaagtgctcgattcaccaaacatggaattggacaagtggctcacgatggttccaagaagtactagtggccgtgctcttgaaggagtcaaaccgcctaaactacaggtatcgatcaaagttggagtccaagcagaagtgggaatggagaagaggcagagaaggacgaagaagtgggatgagtgtggttgtgaagatggtcatggttatggttgcacatgtgctgattacgaaatttttgcactagcagctttgctagaggctctttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Protein Analysis

197

Amino Acids

22.31

Weight (kDa)

7.57

Isoelectric Point (pI)

51.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007243)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G10210 AT5G65030
fragaria_vesca	FvH4_1g20980
prunus_persica	Prupe.6G186100_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0114461 RchiOBHm_Chr2g0114471
rosa_laevigata	RLG00000018103 RLG00000018104
rosa_multiflora	Rmu_co8319255.1_g000001 Rmu_sc0000431.1_g000035 Rmu_sc0000431.1_g000038 Rmu_sc0003151.1_g000023 Rmu_sc0017189.1_g000003
rosa_roxburghii	Rroxscaffold_2G00130170 Rroxscaffold_2G00130180
rosa_rugosa	Rorug02G0190500 Rorug02G0190500
rosa_samantha	Rh2AG247600 Rh2BG257600 Rh2BG257700 Rh2CG251100 Rh2DG255700 Rh2DG255800
rosa_wichuraiana	Rw2G019260 Rw2G019270

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	419
AclWI	GGATC	1 cut(s)	298
AcoI	YGGCCR	1 cut(s)	394
AcsI	RAATTY	1 cut(s)	558
AfaI	GTAC	3 cut(s)	71, 300, 388
AfiI	CCNNNNNNNGG	1 cut(s)	275
AflIII	ACRYGT	1 cut(s)	542
AgsI	TTSAA	1 cut(s)	407
AhlI	ACTAGT	1 cut(s)	389
AluBI	AGCT	5 cut(s)	19, 33, 219, 247, 575
AluI	AGCT	5 cut(s)	19, 33, 219, 247, 575
Alw21I	GWGCWC	3 cut(s)	249, 336, 403
AlwI	GGATC	1 cut(s)	298
Ama87I	CYCGRG	1 cut(s)	147
AoxI	GGCC	1 cut(s)	394
ApeKI	GCWGC	1 cut(s)	572
ApoI	RAATTY	1 cut(s)	558
ArsI	GACNNNNNNTTYG	2 cut(s)	435, 467
AspS9I	GGNCC	1 cut(s)	316
AsuHPI	GGTGA	2 cut(s)	151, 333
AvaI	CYCGRG	1 cut(s)	147
AvaII	GGWCC	1 cut(s)	316
BanII	GRGCYC	1 cut(s)	249
Bbv12I	GWGCWC	3 cut(s)	249, 336, 403
BbvI	GCAGC	1 cut(s)	584
BccI	CCATC	2 cut(s)	367, 515
BceAI	ACGGC	1 cut(s)	381
BcgI	CGANNNNNNTGC	2 cut(s)	545, 579
BcuI	ACTAGT	1 cut(s)	389
BfaI	CTAG	3 cut(s)	390, 569, 581
BfmI	CTRYAG	2 cut(s)	114, 428
BisI	GCNGC	1 cut(s)	573
BlsI	GCNGC	1 cut(s)	574
BmcAI	AGTACT	2 cut(s)	300, 388
Bme18I	GGWCC	1 cut(s)	316
BmeT110I	CYCGRG	1 cut(s)	147
BmgT120I	GGNCC	1 cut(s)	316
BmiI	GGNNCC	2 cut(s)	318, 378
BmrI	ACTGGG	1 cut(s)	311
BmuI	ACTGGG	1 cut(s)	311
Bsa29I	ATCGAT	1 cut(s)	437
BsaJI	CCNNGG	3 cut(s)	81, 195, 320
BsaWI	WCCGGW	1 cut(s)	249
Bsc4I	CCNNNNNNNGG	1 cut(s)	275
Bse1I	ACTGG	1 cut(s)	306
BseCI	ATCGAT	1 cut(s)	437
BseDI	CCNNGG	3 cut(s)	81, 195, 320
BseGI	GGATG	1 cut(s)	508
BseLI	CCNNNNNNNGG	1 cut(s)	275
BseMII	CTCAG	1 cut(s)	32
BseNI	ACTGG	1 cut(s)	306
BseXI	GCAGC	1 cut(s)	584
BshFI	GGCC	1 cut(s)	396
BshVI	ATCGAT	1 cut(s)	437
BsiHKAI	GWGCWC	3 cut(s)	249, 336, 403
BsiHKCI	CYCGRG	1 cut(s)	147
BsiSI	CCGG	1 cut(s)	250
BslFI	GGGAC	2 cut(s)	134, 302
BslI	CCNNNNNNNGG	1 cut(s)	275
BsmFI	GGGAC	2 cut(s)	134, 302
BsmI	GAATGC	1 cut(s)	6
BsnI	GGCC	1 cut(s)	396
BsoBI	CYCGRG	1 cut(s)	147
Bsp1286I	GDGCHC	3 cut(s)	249, 336, 403
Bsp143I	GATC	2 cut(s)	290, 438
Bsp19I	CCATGG	1 cut(s)	320
BspACI	CCGC	1 cut(s)	419
BspANI	GGCC	1 cut(s)	396
BspCNI	CTCAG	1 cut(s)	33
BspDI	ATCGAT	1 cut(s)	437
BspLI	GGNNCC	2 cut(s)	318, 378
BspMAI	CTGCAG	1 cut(s)	118
BspPI	GGATC	1 cut(s)	298
BsrI	ACTGG	1 cut(s)	306
BssECI	CCNNGG	3 cut(s)	81, 195, 320
BssMI	GATC	2 cut(s)	290, 438
BssT1I	CCWWGG	2 cut(s)	195, 320
Bst4CI	ACNGT	2 cut(s)	235, 265
Bst6I	CTCTTC	1 cut(s)	470
BstDEI	CTNAG	2 cut(s)	29, 41
BstDSI	CCRYGG	2 cut(s)	81, 320
BstF5I	GGATG	1 cut(s)	508
BstKTI	GATC	2 cut(s)	293, 441
BstMBI	GATC	2 cut(s)	290, 438
BstMWI	GCNNNNNNNGC	1 cut(s)	572
BstNSI	RCATGY	1 cut(s)	546
BstSFI	CTRYAG	2 cut(s)	114, 428
BstV1I	GCAGC	1 cut(s)	584
Bsu15I	ATCGAT	1 cut(s)	437
BsuRI	GGCC	1 cut(s)	396
BsuTUI	ATCGAT	1 cut(s)	437
BtgI	CCRYGG	2 cut(s)	81, 320
BtsCI	GGATG	1 cut(s)	508
Cfr13I	GGNCC	1 cut(s)	316
ClaI	ATCGAT	1 cut(s)	437
Csp6I	GTAC	3 cut(s)	70, 299, 387
CviAII	CATG	4 cut(s)	321, 349, 527, 543
CviQI	GTAC	3 cut(s)	70, 299, 387
DdeI	CTNAG	2 cut(s)	29, 41
DpnI	GATC	2 cut(s)	292, 440
DpnII	GATC	2 cut(s)	290, 438
EaeI	YGGCCR	1 cut(s)	394
Eam1104I	CTCTTC	1 cut(s)	470
EarI	CTCTTC	1 cut(s)	470
Ecl136II	GAGCTC	1 cut(s)	247
Eco130I	CCWWGG	2 cut(s)	195, 320
Eco24I	GRGCYC	1 cut(s)	249
Eco47I	GGWCC	1 cut(s)	316
Eco53kI	GAGCTC	1 cut(s)	247
Eco88I	CYCGRG	1 cut(s)	147
EcoICRI	GAGCTC	1 cut(s)	247
EcoO109I	RGGNCCY	1 cut(s)	316
EcoT14I	CCWWGG	2 cut(s)	195, 320
EcoT38I	GRGCYC	1 cut(s)	249
ErhI	CCWWGG	2 cut(s)	195, 320
FaeI	CATG	4 cut(s)	324, 352, 530, 546
FaiI	YATR	7 cut(s)	50, 65, 322, 350, 528, 534, 544
FaqI	GGGAC	2 cut(s)	134, 302
FatI	CATG	4 cut(s)	320, 348, 526, 542
Fnu4HI	GCNGC	1 cut(s)	573
FokI	GGATG	1 cut(s)	515
FriOI	GRGCYC	1 cut(s)	249
Fsp4HI	GCNGC	1 cut(s)	573
FspBI	CTAG	3 cut(s)	390, 569, 581
GluI	GCNGC	1 cut(s)	573
HaeIII	GGCC	1 cut(s)	396
HapII	CCGG	1 cut(s)	250
Hin1II	CATG	4 cut(s)	324, 352, 530, 546
HinfI	GANTC	5 cut(s)	45, 185, 338, 411, 450
HpaII	CCGG	1 cut(s)	250
HphI	GGTGA	2 cut(s)	151, 333
Hpy166II	GTNNAC	1 cut(s)	38
Hpy188I	TCNGA	2 cut(s)	101, 169
Hpy188III	TCNNGA	5 cut(s)	76, 149, 178, 370, 404
Hpy8I	GTNNAC	1 cut(s)	38
HpyAV	CCTTC	2 cut(s)	401, 480
HpyCH4III	ACNGT	2 cut(s)	235, 265
HpyCH4V	TGCA	3 cut(s)	116, 540, 566
HpyF10VI	GCNNNNNNNGC	1 cut(s)	572
HpyF3I	CTNAG	2 cut(s)	29, 41
Hsp92II	CATG	4 cut(s)	324, 352, 530, 546
Kzo9I	GATC	2 cut(s)	290, 438
LmnI	GCTCC	1 cut(s)	252
LpnPI	CCDG	8 cut(s)	102, 104, 163, 263, 282, 287, 292, 416
Lsp1109I	GCAGC	1 cut(s)	584
MaeI	CTAG	3 cut(s)	390, 569, 581
MalI	GATC	2 cut(s)	292, 440
MboI	GATC	2 cut(s)	290, 438
MboII	GAAGA	7 cut(s)	15, 141, 148, 291, 487, 505, 530
MhlI	GDGCHC	3 cut(s)	249, 336, 403
MluCI	AATT	4 cut(s)	132, 282, 353, 558
MlyI	GAGTC	3 cut(s)	194, 420, 459
MmeI	TCCRAC	1 cut(s)	427
MnlI	CCTC	4 cut(s)	249, 307, 471, 577
MslI	CAYNNNNRTG	1 cut(s)	531
MspI	CCGG	1 cut(s)	250
Mva1269I	GAATGC	1 cut(s)	6
MwoI	GCNNNNNNNGC	1 cut(s)	572
NcoI	CCATGG	1 cut(s)	320
NdeII	GATC	2 cut(s)	290, 438
NlaIII	CATG	4 cut(s)	324, 352, 530, 546
NlaIV	GGNNCC	2 cut(s)	318, 378
NspI	RCATGY	1 cut(s)	546
PaeR7I	CTCGAG	1 cut(s)	147
PciI	ACATGT	1 cut(s)	542
PctI	GAATGC	1 cut(s)	6
PfeI	GAWTC	2 cut(s)	45, 338
PkrI	GCNGC	1 cut(s)	574
PleI	GAGTC	3 cut(s)	193, 419, 458
PpsI	GAGTC	3 cut(s)	193, 419, 458
PpuMI	RGGWCCY	1 cut(s)	316
PscI	ACATGT	1 cut(s)	542
Psp124BI	GAGCTC	1 cut(s)	249
Psp5II	RGGWCCY	1 cut(s)	316
PspN4I	GGNNCC	2 cut(s)	318, 378
PspPI	GGNCC	1 cut(s)	316
PspPPI	RGGWCCY	1 cut(s)	316
PstI	CTGCAG	1 cut(s)	118
RsaI	GTAC	3 cut(s)	71, 300, 388
RsaNI	GTAC	3 cut(s)	70, 299, 387
RseI	CAYNNNNRTG	1 cut(s)	531
SacI	GAGCTC	1 cut(s)	249
SatI	GCNGC	1 cut(s)	573
Sau3AI	GATC	2 cut(s)	290, 438
Sau96I	GGNCC	1 cut(s)	316
ScaI	AGTACT	2 cut(s)	300, 388
SchI	GAGTC	3 cut(s)	194, 420, 459
SduI	GDGCHC	3 cut(s)	249, 336, 403
SetI	ASST	8 cut(s)	21, 35, 93, 221, 249, 318, 435, 577
SfcI	CTRYAG	2 cut(s)	114, 428
Sfr274I	CTCGAG	1 cut(s)	147
SinI	GGWCC	1 cut(s)	316
SlaI	CTCGAG	1 cut(s)	147
SmiMI	CAYNNNNRTG	1 cut(s)	531
SmlI	CTYRAG	1 cut(s)	147
SmoI	CTYRAG	1 cut(s)	147
SpeI	ACTAGT	1 cut(s)	389
Sse9I	AATT	4 cut(s)	132, 282, 353, 558
SsiI	CCGC	1 cut(s)	419
SspMI	CTAG	3 cut(s)	390, 569, 581
SstI	GAGCTC	1 cut(s)	249
StyI	CCWWGG	2 cut(s)	195, 320
TaaI	ACNGT	2 cut(s)	235, 265
TaqI	TCGA	3 cut(s)	148, 336, 437
TasI	AATT	4 cut(s)	132, 282, 353, 558
TatI	WGTACW	3 cut(s)	69, 298, 386
TfiI	GAWTC	2 cut(s)	45, 338
TseI	GCWGC	1 cut(s)	572
VpaK11BI	GGWCC	1 cut(s)	316
XapI	RAATTY	1 cut(s)	558
XceI	RCATGY	1 cut(s)	546
XhoI	CTCGAG	1 cut(s)	147
XspI	CTAG	3 cut(s)	390, 569, 581
ZrmI	AGTACT	2 cut(s)	300, 388

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.