Rmu_sc0000580.1_g000113

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000580.1
OG0017455
Physical Location & Seq
Reverse (-)
483634 .. 484254
621 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000580.1_g000113.1.cds

Sequence Viewer

Length: 621 bp
atgccttttcccttcagttttaagcccttcactagacccccggatggattagagaatttacaggtggctgacttaattgacagtgatctgcatgagtggaattttgcggtgctacaggagctattttcgccttcagaagttgaaataatagggcgcattcctctaagtacgagtggtccagaggacagattaacatggtactatgacaagaagggctgttatagtgttcgttctggctatcatgtggctcggaatgcagttgatcgagtatctagggcgtctgcatctaatggttcttttggggtcaatagtaaattctggagaagactctggcatgcacgtacacctcctaaggtacggtcctttatgtggagagtcttaaaaggtattctacctactaaagtttcccttgcacgacgtgtcactctcccacatatgaaatgtgttctatgcaatagttcaattgaggatggtattcatctttttaaggattgtgacattgctggcggtacttggttggctagtaacttgggtgtgcatgtgaagaatattcctggacgtcatttggaggaatgggttcttaatgtcatggaattattgcatggaggtcaatttttttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_3 zf-RVT

Protein Analysis

206

Amino Acids

23.44

Weight (kDa)

9.14

Isoelectric Point (pI)

46.37

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 562
AciI CCGC 2 cut(s) 107, 507
AcsI RAATTY 3 cut(s) 55, 100, 314
AcuI CTGAAG 1 cut(s) 117
AcyI GRCGYC 2 cut(s) 278, 559
AdeI CACNNNGTG 1 cut(s) 419
AfaI GTAC 5 cut(s) 169, 200, 343, 357, 511
AfiI CCNNNNNNNGG 2 cut(s) 44, 369
AflIII ACRYGT 1 cut(s) 418
AgsI TTSAA 2 cut(s) 143, 462
AjiI CACGTC 1 cut(s) 419
AjnI CCWGG 1 cut(s) 553
AluBI AGCT 1 cut(s) 121
AluI AGCT 1 cut(s) 121
ApoI RAATTY 3 cut(s) 55, 100, 314
Asp700I GAANNNNTTC 1 cut(s) 576
AspLEI GCGC 1 cut(s) 156
AspS9I GGNCC 2 cut(s) 176, 360
AsuC2I CCSGG 1 cut(s) 41
AvaII GGWCC 2 cut(s) 176, 360
AxyI CCTNAGG 1 cut(s) 351
BbsI GAAGAC 1 cut(s) 331
BccI CCATC 2 cut(s) 38, 464
BciT130I CCWGG 1 cut(s) 555
BcnI CCSGG 1 cut(s) 41
BfaI CTAG 3 cut(s) 33, 273, 522
BfmI CTRYAG 1 cut(s) 113
Bme1390I CCNGG 2 cut(s) 41, 555
Bme18I GGWCC 2 cut(s) 176, 360
BmgBI CACGTC 1 cut(s) 419
BmgT120I GGNCC 2 cut(s) 176, 360
BmrFI CCNGG 2 cut(s) 41, 555
BmsI GCATC 1 cut(s) 293
BpiI GAAGAC 1 cut(s) 331
BpmI CTGGAG 1 cut(s) 340
BpuMI CCSGG 1 cut(s) 41
BsaAI YACGTR 1 cut(s) 341
BsaHI GRCGYC 2 cut(s) 278, 559
BsaJI CCNNGG 1 cut(s) 39
Bsc4I CCNNNNNNNGG 2 cut(s) 44, 369
Bse21I CCTNAGG 1 cut(s) 351
Bse3DI GCAATG 1 cut(s) 498
BseBI CCWGG 1 cut(s) 555
BseDI CCNNGG 1 cut(s) 39
BseGI GGATG 2 cut(s) 49, 475
BseLI CCNNNNNNNGG 2 cut(s) 44, 369
BseMI GCAATG 1 cut(s) 498
BsiSI CCGG 1 cut(s) 41
BslI CCNNNNNNNGG 2 cut(s) 44, 369
BsmI GAATGC 2 cut(s) 156, 259
Bsp143I GATC 2 cut(s) 85, 262
BspACI CCGC 2 cut(s) 107, 507
BsrDI GCAATG 1 cut(s) 498
BssECI CCNNGG 1 cut(s) 39
BssMI GATC 2 cut(s) 85, 262
BssNI GRCGYC 2 cut(s) 278, 559
Bst2UI CCWGG 1 cut(s) 555
Bst4CI ACNGT 2 cut(s) 83, 360
BstACI GRCGYC 2 cut(s) 278, 559
BstBAI YACGTR 1 cut(s) 341
BstC8I GCNNGC 2 cut(s) 336, 505
BstDEI CTNAG 2 cut(s) 164, 351
BstF5I GGATG 2 cut(s) 49, 475
BstHHI GCGC 1 cut(s) 156
BstKTI GATC 2 cut(s) 88, 265
BstMBI GATC 2 cut(s) 85, 262
BstMWI GCNNNNNNNGC 3 cut(s) 118, 127, 254
BstNI CCWGG 1 cut(s) 555
BstNSI RCATGY 2 cut(s) 338, 542
BstSCI CCNGG 2 cut(s) 39, 553
BstSFI CTRYAG 1 cut(s) 113
BstV2I GAAGAC 1 cut(s) 331
Bsu36I CCTNAGG 1 cut(s) 351
BtrI CACGTC 1 cut(s) 419
BtsCI GGATG 2 cut(s) 49, 475
BtsIMutI CAGTG 1 cut(s) 88
Cac8I GCNNGC 2 cut(s) 336, 505
CfoI GCGC 1 cut(s) 156
Cfr13I GGNCC 2 cut(s) 176, 360
CseI GACGC 1 cut(s) 267
Csp6I GTAC 5 cut(s) 168, 199, 342, 356, 510
CviAII CATG 7 cut(s) 92, 195, 242, 335, 539, 589, 602
CviJI RGCY 7 cut(s) 25, 68, 121, 216, 237, 248, 521
CviKI_1 RGCY 7 cut(s) 25, 68, 121, 216, 237, 248, 521
CviQI GTAC 5 cut(s) 168, 199, 342, 356, 510
DdeI CTNAG 2 cut(s) 164, 351
DpnI GATC 2 cut(s) 87, 264
DpnII GATC 2 cut(s) 85, 262
DraIII CACNNNGTG 1 cut(s) 419
Eco47I GGWCC 2 cut(s) 176, 360
Eco57I CTGAAG 1 cut(s) 117
Eco81I CCTNAGG 1 cut(s) 351
EcoRII CCWGG 1 cut(s) 553
FaeI CATG 7 cut(s) 95, 198, 245, 338, 542, 592, 605
FalI AAGNNNNNCTT 2 cut(s) 393, 425
FatI CATG 7 cut(s) 91, 194, 241, 334, 538, 588, 601
FauNDI CATATG 1 cut(s) 435
FokI GGATG 2 cut(s) 56, 482
FspBI CTAG 3 cut(s) 33, 273, 522
GlaI GCGC 1 cut(s) 155
GsuI CTGGAG 1 cut(s) 340
HapII CCGG 1 cut(s) 41
HgaI GACGC 1 cut(s) 267
HhaI GCGC 1 cut(s) 156
Hin1I GRCGYC 2 cut(s) 278, 559
Hin1II CATG 7 cut(s) 95, 198, 245, 338, 542, 592, 605
Hin6I GCGC 1 cut(s) 154
HinP1I GCGC 1 cut(s) 154
HinfI GANTC 2 cut(s) 327, 375
HpaII CCGG 1 cut(s) 41
Hpy166II GTNNAC 1 cut(s) 344
Hpy188I TCNGA 2 cut(s) 136, 252
Hpy188III TCNNGA 2 cut(s) 179, 319
Hpy8I GTNNAC 1 cut(s) 344
Hpy99I CGWCG 1 cut(s) 420
HpyAV CCTTC 4 cut(s) 22, 37, 141, 205
HpyCH4III ACNGT 2 cut(s) 83, 360
HpyCH4IV ACGT 3 cut(s) 340, 418, 559
HpyCH4V TGCA 8 cut(s) 91, 257, 284, 338, 413, 453, 538, 601
HpyF10VI GCNNNNNNNGC 3 cut(s) 118, 127, 254
HpyF3I CTNAG 2 cut(s) 164, 351
HpySE526I ACGT 3 cut(s) 340, 418, 559
Hsp92I GRCGYC 2 cut(s) 278, 559
Hsp92II CATG 7 cut(s) 95, 198, 245, 338, 542, 592, 605
HspAI GCGC 1 cut(s) 154
Kzo9I GATC 2 cut(s) 85, 262
LmnI GCTCC 1 cut(s) 118
LweI GCATC 1 cut(s) 293
MaeI CTAG 3 cut(s) 33, 273, 522
MaeII ACGT 3 cut(s) 340, 418, 559
MaeIII GTNAC 3 cut(s) 421, 494, 524
MalI GATC 2 cut(s) 87, 264
MboI GATC 2 cut(s) 85, 262
MboII GAAGA 2 cut(s) 336, 556
MfeI CAATTG 1 cut(s) 462
MluCI AATT 7 cut(s) 55, 75, 100, 314, 462, 593, 611
MlyI GAGTC 2 cut(s) 321, 384
MnlI CCTC 6 cut(s) 171, 175, 357, 460, 562, 599
MroXI GAANNNNTTC 1 cut(s) 576
MseI TTAA 6 cut(s) 21, 74, 191, 380, 486, 582
MspI CCGG 1 cut(s) 41
MspR9I CCNGG 2 cut(s) 41, 555
MunI CAATTG 1 cut(s) 462
Mva1269I GAATGC 2 cut(s) 156, 259
MvaI CCWGG 1 cut(s) 555
MwoI GCNNNNNNNGC 3 cut(s) 118, 127, 254
NciI CCSGG 1 cut(s) 41
NdeI CATATG 1 cut(s) 435
NdeII GATC 2 cut(s) 85, 262
NlaIII CATG 7 cut(s) 95, 198, 245, 338, 542, 592, 605
NmuCI GTSAC 2 cut(s) 421, 494
NspI RCATGY 2 cut(s) 338, 542
PaeI GCATGC 1 cut(s) 338
PctI GAATGC 2 cut(s) 156, 259
PdmI GAANNNNTTC 1 cut(s) 576
PfoI TCCNGGA 1 cut(s) 553
PleI GAGTC 2 cut(s) 321, 383
PpsI GAGTC 2 cut(s) 321, 383
Ppu21I YACGTR 1 cut(s) 341
Psp6I CCWGG 1 cut(s) 553
PspGI CCWGG 1 cut(s) 553
PspPI GGNCC 2 cut(s) 176, 360
RsaI GTAC 5 cut(s) 169, 200, 343, 357, 511
RsaNI GTAC 5 cut(s) 168, 199, 342, 356, 510
SaqAI TTAA 6 cut(s) 21, 74, 191, 380, 486, 582
Sau3AI GATC 2 cut(s) 85, 262
Sau96I GGNCC 2 cut(s) 176, 360
SchI GAGTC 2 cut(s) 321, 384
ScrFI CCNGG 2 cut(s) 41, 555
SfaNI GCATC 1 cut(s) 293
SfcI CTRYAG 1 cut(s) 113
SinI GGWCC 2 cut(s) 176, 360
SphI GCATGC 1 cut(s) 338
Sse9I AATT 7 cut(s) 55, 75, 100, 314, 462, 593, 611
SsiI CCGC 2 cut(s) 107, 507
SspI AATATT 1 cut(s) 550
SspMI CTAG 3 cut(s) 33, 273, 522
StyD4I CCNGG 2 cut(s) 39, 553
TaaI ACNGT 2 cut(s) 83, 360
TaiI ACGT 3 cut(s) 343, 421, 562
TaqI TCGA 1 cut(s) 265
TasI AATT 7 cut(s) 55, 75, 100, 314, 462, 593, 611
Tru1I TTAA 6 cut(s) 21, 74, 191, 380, 486, 582
Tru9I TTAA 6 cut(s) 21, 74, 191, 380, 486, 582
TscAI CASTG 1 cut(s) 88
TseFI GTSAC 2 cut(s) 421, 494
Tsp45I GTSAC 2 cut(s) 421, 494
TspDTI ATGAA 2 cut(s) 452, 467
TspRI CASTG 1 cut(s) 88
VpaK11BI GGWCC 2 cut(s) 176, 360
XapI RAATTY 3 cut(s) 55, 100, 314
XceI RCATGY 2 cut(s) 338, 542
XmnI GAANNNNTTC 1 cut(s) 576
XspI CTAG 3 cut(s) 33, 273, 522
ZraI GACGTC 1 cut(s) 560
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.