Rmu_sc0001001.1_g000011

Ribonuclease H protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001001.1
OG0017455
Physical Location & Seq
Reverse (-)
48418 .. 48891
474 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001001.1_g000011.1.cds

Sequence Viewer

Length: 474 bp
atggaggtggatattattctgcgcattccactcagccttagaaggactgaggacagacttgtctggcactatgataagaagggtatgtatagtgtacgtaatgggtatcatggggctcgaatggaggaagggaagaaagatcgtgcatcaagttctaatggagtggtgggcgcaaaggggaagtattggaacgtaatctggcattccaagattcctccgaaagtacgagtttttgtatggagattagtgaagggtattctgcccacacgggagctactagtgagaagagttcctcttactgatgcacgttgtgttttttgcatgaagtctgtggagaccggtttgcatgtgtttcgtgattgtgaaaaaattgcatggttctggagctgtactttgttgggattaatgccaaagtttgttcctaccatgtcattggaggaatgggttcttaatgttgttggaggaatggattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RVT_1 RVT_3 zf-RVT

Protein Analysis

157

Amino Acids

18.22

Weight (kDa)

9.73

Isoelectric Point (pI)

43.58

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 59
Acc16I TGCGCA 1 cut(s) 23
AdeI CACNNNGTG 1 cut(s) 311
AfaI GTAC 3 cut(s) 96, 225, 391
AgeI ACCGGT 1 cut(s) 338
AhlI ACTAGT 1 cut(s) 277
AluBI AGCT 2 cut(s) 274, 387
AluI AGCT 2 cut(s) 274, 387
Alw26I GTCTC 1 cut(s) 329
AseI ATTAAT 1 cut(s) 404
AsiGI ACCGGT 1 cut(s) 338
Asp700I GAANNNNTTC 1 cut(s) 444
AspLEI GCGC 2 cut(s) 24, 173
BanII GRGCYC 1 cut(s) 118
BcgI CGANNNNNNTGC 2 cut(s) 335, 369
BcoDI GTCTC 1 cut(s) 329
BcuI ACTAGT 1 cut(s) 277
BfaI CTAG 1 cut(s) 278
BmsI GCATC 2 cut(s) 155, 292
BpmI CTGGAG 1 cut(s) 403
BsaAI YACGTR 1 cut(s) 98
BsaI GGTCTC 1 cut(s) 329
BsaWI WCCGGW 1 cut(s) 338
Bse118I RCCGGY 1 cut(s) 338
BseMII CTCAG 2 cut(s) 39, 46
BshTI ACCGGT 1 cut(s) 338
BsiSI CCGG 1 cut(s) 339
BsmAI GTCTC 1 cut(s) 329
BsmI GAATGC 2 cut(s) 24, 202
Bso31I GGTCTC 1 cut(s) 329
Bsp1286I GDGCHC 1 cut(s) 118
Bsp143I GATC 1 cut(s) 139
BspCNI CTCAG 2 cut(s) 40, 45
BspTNI GGTCTC 1 cut(s) 329
BsrFI RCCGGY 1 cut(s) 338
BssAI RCCGGY 1 cut(s) 338
BssMI GATC 1 cut(s) 139
Bst6I CTCTTC 1 cut(s) 280
BstBAI YACGTR 1 cut(s) 98
BstDEI CTNAG 3 cut(s) 32, 38, 48
BstHHI GCGC 2 cut(s) 24, 173
BstKTI GATC 1 cut(s) 142
BstMAI GTCTC 1 cut(s) 329
BstMBI GATC 1 cut(s) 139
BstNSI RCATGY 1 cut(s) 350
BstSNI TACGTA 1 cut(s) 98
BstXI CCANNNNNNTGG 1 cut(s) 433
CfoI GCGC 2 cut(s) 24, 173
Cfr10I RCCGGY 1 cut(s) 338
Csp6I GTAC 3 cut(s) 95, 224, 390
CspAI ACCGGT 1 cut(s) 338
CviAII CATG 5 cut(s) 110, 322, 347, 375, 427
CviJI RGCY 4 cut(s) 36, 116, 274, 387
CviKI_1 RGCY 4 cut(s) 36, 116, 274, 387
CviQI GTAC 3 cut(s) 95, 224, 390
DdeI CTNAG 3 cut(s) 32, 38, 48
DpnI GATC 1 cut(s) 141
DpnII GATC 1 cut(s) 139
DraIII CACNNNGTG 1 cut(s) 311
DrdI GACNNNNNNGTC 1 cut(s) 59
DseDI GACNNNNNNGTC 1 cut(s) 59
Eam1104I CTCTTC 1 cut(s) 280
EarI CTCTTC 1 cut(s) 280
Eco105I TACGTA 1 cut(s) 98
Eco24I GRGCYC 1 cut(s) 118
Eco31I GGTCTC 1 cut(s) 329
EcoT38I GRGCYC 1 cut(s) 118
FaeI CATG 5 cut(s) 113, 325, 350, 378, 430
FaiI YATR 9 cut(s) 72, 86, 90, 111, 238, 323, 348, 376, 428
FatI CATG 5 cut(s) 109, 321, 346, 374, 426
FriOI GRGCYC 1 cut(s) 118
FspBI CTAG 1 cut(s) 278
FspI TGCGCA 1 cut(s) 23
GlaI GCGC 2 cut(s) 23, 172
GsuI CTGGAG 1 cut(s) 403
HapII CCGG 1 cut(s) 339
HhaI GCGC 2 cut(s) 24, 173
Hin1II CATG 5 cut(s) 113, 325, 350, 378, 430
Hin6I GCGC 2 cut(s) 22, 171
HinP1I GCGC 2 cut(s) 22, 171
HinfI GANTC 1 cut(s) 211
HpaII CCGG 1 cut(s) 339
Hpy166II GTNNAC 1 cut(s) 95
Hpy188I TCNGA 1 cut(s) 219
Hpy188III TCNNGA 2 cut(s) 356, 382
Hpy8I GTNNAC 1 cut(s) 95
HpyAV CCTTC 4 cut(s) 36, 73, 122, 244
HpyCH4IV ACGT 3 cut(s) 97, 192, 307
HpyCH4V TGCA 5 cut(s) 146, 305, 321, 346, 374
HpyF3I CTNAG 3 cut(s) 32, 38, 48
HpySE526I ACGT 3 cut(s) 97, 192, 307
Hsp92II CATG 5 cut(s) 113, 325, 350, 378, 430
HspAI GCGC 2 cut(s) 22, 171
Kzo9I GATC 1 cut(s) 139
LmnI GCTCC 2 cut(s) 271, 384
LpnPI CCDG 4 cut(s) 49, 184, 352, 367
LweI GCATC 2 cut(s) 155, 292
MaeI CTAG 1 cut(s) 278
MaeII ACGT 3 cut(s) 97, 192, 307
MalI GATC 1 cut(s) 141
MboI GATC 1 cut(s) 139
MboII GAAGA 2 cut(s) 145, 297
MhlI GDGCHC 1 cut(s) 118
MluCI AATT 1 cut(s) 369
MmeI TCCRAC 1 cut(s) 439
MnlI CCTC 6 cut(s) 43, 118, 225, 303, 430, 455
MroXI GAANNNNTTC 1 cut(s) 444
MseI TTAA 3 cut(s) 404, 450, 472
MspI CCGG 1 cut(s) 339
Mva1269I GAATGC 2 cut(s) 24, 202
NdeII GATC 1 cut(s) 139
NlaIII CATG 5 cut(s) 113, 325, 350, 378, 430
NsbI TGCGCA 1 cut(s) 23
NspI RCATGY 1 cut(s) 350
PctI GAATGC 2 cut(s) 24, 202
PdmI GAANNNNTTC 1 cut(s) 444
PfeI GAWTC 1 cut(s) 211
PinAI ACCGGT 1 cut(s) 338
Ppu21I YACGTR 1 cut(s) 98
PshBI ATTAAT 1 cut(s) 404
RsaI GTAC 3 cut(s) 96, 225, 391
RsaNI GTAC 3 cut(s) 95, 224, 390
SaqAI TTAA 3 cut(s) 404, 450, 472
Sau3AI GATC 1 cut(s) 139
SduI GDGCHC 1 cut(s) 118
SetI ASST 6 cut(s) 9, 100, 195, 276, 310, 389
SfaNI GCATC 2 cut(s) 155, 292
SnaBI TACGTA 1 cut(s) 98
SpeI ACTAGT 1 cut(s) 277
Sse9I AATT 1 cut(s) 369
SspMI CTAG 1 cut(s) 278
TaiI ACGT 3 cut(s) 100, 195, 310
TaqI TCGA 1 cut(s) 118
TasI AATT 1 cut(s) 369
TatI WGTACW 1 cut(s) 389
TfiI GAWTC 1 cut(s) 211
Tru1I TTAA 3 cut(s) 404, 450, 472
Tru9I TTAA 3 cut(s) 404, 450, 472
TspDTI ATGAA 1 cut(s) 338
VspI ATTAAT 1 cut(s) 404
XceI RCATGY 1 cut(s) 350
XmnI GAANNNNTTC 1 cut(s) 444
XspI CTAG 1 cut(s) 278
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.