Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000596.1

Orthogroup ID

OG0017240

Physical Location & Seq

Genomic Coordinates Forward (+)

100994 .. 106045

Gene Structure 5052 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000596.1_g000019.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1068 bp

atgacggatctgagtaagttcgtagagtcagctcgtgaaaatcataaatttattcaatctgttgttcaacagtactttgacaacgggctgccaactggagtcggaggaagtcgctgcaggatgattttggagaaactgaagaagctcaagacctctgatgaccactgtgctgaaaggctgctcgaacagatcgaatctttgcgcaatgagtacgaaaatacgctcgaaaattctgaacttgcaaaacacgagattgagatggagcatgaacgtgcatgtgctctggaaaaacgaaaaacaaagaaaaataaacgcactgcgacaactttgctcatttgcggcactgtggcagctactatggttggtcatccattcatgggtgccgctgccgctatggttgttcgtcgacaagtttctaaagcctgtagctcaagaactaaagaggaagaacaacgacatgaaattgctttcaaggatcactacgcaatggaaggaaaaatgattattagcattaaggagctgggcagcattaagtttctcattgataaggttgtaaatgagatcgattcactcttgagaagtgtagagggagcaattaacactggagaagtagatttcgcaatgaagactattaagaataagatggaaacagtcgaagtttttcgactgacccgacccgaacccggcgttccgacccgacttttccggccgactgcggtggtctccggccgtgaaactttccagacaggatcgcctccgccgtctggtagtccctctggtgctctctatcgccgattcttctccacggcggcgctgcaaggtggtgcagccttgtgttttcggacccggccggaaaacacaactccggcgacctcgtggcttcaggcttcttgggttgagttcagaacaagctcactggtcgatccttggtgtttgtttcgaccggtttacgtgaaaactcgatcaactcggattggatcactgttcacgaattgtgaggtagttttcgatcccttaagcttgttttctgacttcgatccagttatgaaagttcacaagcatgcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF677

Protein Analysis

355

Amino Acids

39.95

Weight (kDa)

9.03

Isoelectric Point (pI)

48.33

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017240)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g08060
rosa_laevigata	RLG00000014402 RLG00000014413 RLG00000014417
rosa_multiflora	Rmu_sc0000596.1_g000019 Rmu_sc0007280.1_g000003
rosa_roxburghii	Rroxscaffold_7G00205060 Rroxscaffold_7G00205160
rosa_rugosa	Rorug05G0598200
rosa_samantha	Rh6AG119400 Rh6BG113500 Rh6CG111700 Rh6DG101400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	203
AccB1I	GGYRCC	1 cut(s)	380
AccI	GTMKAC	1 cut(s)	406
AciI	CCGC	6 cut(s)	339, 384, 390, 716, 758, 809
AclWI	GGATC	7 cut(s)	15, 483, 757, 917, 985, 1004, 1031
AcoI	YGGCCR	3 cut(s)	707, 727, 848
AcsI	RAATTY	2 cut(s)	47, 229
AcuI	CTGAAG	2 cut(s)	158, 866
AfaI	GTAC	2 cut(s)	74, 212
AfiI	CCNNNNNNNGG	3 cut(s)	377, 683, 764
AflII	CTTAAG	1 cut(s)	1015
AgeI	ACCGGT	1 cut(s)	943
AgsI	TTSAA	3 cut(s)	56, 68, 472
AluBI	AGCT	7 cut(s)	32, 145, 353, 429, 520, 912, 1020
AluI	AGCT	7 cut(s)	32, 145, 353, 429, 520, 912, 1020
Alw21I	GWGCWC	2 cut(s)	283, 784
Alw26I	GTCTC	1 cut(s)	727
AlwI	GGATC	7 cut(s)	15, 483, 757, 917, 985, 1004, 1031
AoxI	GGCC	3 cut(s)	707, 727, 848
ApeKI	GCWGC	8 cut(s)	88, 114, 178, 350, 386, 525, 814, 827
ApoI	RAATTY	2 cut(s)	47, 229
AsiGI	ACCGGT	1 cut(s)	943
Asp700I	GAANNNNTTC	1 cut(s)	660
AspLEI	GCGC	2 cut(s)	204, 814
AspS9I	GGNCC	1 cut(s)	843
AsuC2I	CCSGG	2 cut(s)	684, 847
AvaII	GGWCC	1 cut(s)	843
BanI	GGYRCC	1 cut(s)	380
BauI	CACGAG	3 cut(s)	33, 248, 874
BbsI	GAAGAC	1 cut(s)	632
Bbv12I	GWGCWC	2 cut(s)	283, 784
BbvI	GCAGC	8 cut(s)	75, 101, 165, 362, 373, 537, 801, 839
BccI	CCATC	2 cut(s)	253, 637
BceAI	ACGGC	3 cut(s)	714, 745, 822
BcgI	CGANNNNNNTGC	2 cut(s)	310, 344
BcnI	CCSGG	2 cut(s)	684, 847
BcoDI	GTCTC	1 cut(s)	727
BfmI	CTRYAG	2 cut(s)	115, 424
BfoI	RGCGCY	1 cut(s)	815
BfrI	CTTAAG	1 cut(s)	1015
BmcAI	AGTACT	1 cut(s)	74
Bme1390I	CCNGG	2 cut(s)	684, 847
Bme18I	GGWCC	1 cut(s)	843
BmgT120I	GGNCC	1 cut(s)	843
BmiI	GGNNCC	2 cut(s)	382, 845
BmrFI	CCNGG	2 cut(s)	684, 847
BpiI	GAAGAC	1 cut(s)	632
BpmI	CTGGAG	2 cut(s)	117, 624
BpuEI	CTTGAG	3 cut(s)	131, 415, 595
BpuMI	CCSGG	2 cut(s)	684, 847
Bsa29I	ATCGAT	1 cut(s)	564
BsaAI	YACGTR	1 cut(s)	952
BsaI	GGTCTC	1 cut(s)	727
BsaJI	CCNNGG	2 cut(s)	804, 926
BsaWI	WCCGGW	1 cut(s)	943
Bsc4I	CCNNNNNNNGG	3 cut(s)	377, 683, 764
Bse118I	RCCGGY	1 cut(s)	943
Bse1I	ACTGG	4 cut(s)	100, 607, 921, 1040
Bse3DI	GCAATG	3 cut(s)	211, 492, 627
BseCI	ATCGAT	1 cut(s)	564
BseDI	CCNNGG	2 cut(s)	804, 926
BseGI	GGATG	2 cut(s)	126, 367
BseLI	CCNNNNNNNGG	3 cut(s)	377, 683, 764
BseMI	GCAATG	3 cut(s)	211, 492, 627
BseNI	ACTGG	4 cut(s)	100, 607, 921, 1040
BseX3I	CGGCCG	3 cut(s)	707, 727, 848
BseXI	GCAGC	8 cut(s)	75, 101, 165, 362, 373, 537, 801, 839
BseYI	CCCAGC	1 cut(s)	520
BsgI	GTGCAG	1 cut(s)	846
Bsh1285I	CGRYCG	4 cut(s)	710, 730, 851, 944
BshFI	GGCC	3 cut(s)	709, 729, 850
BshNI	GGYRCC	1 cut(s)	380
BshTI	ACCGGT	1 cut(s)	943
BshVI	ATCGAT	1 cut(s)	564
BsiEI	CGRYCG	4 cut(s)	710, 730, 851, 944
BsiHKAI	GWGCWC	2 cut(s)	283, 784
BsiSI	CCGG	7 cut(s)	684, 706, 726, 847, 851, 866, 944
BslFI	GGGAC	1 cut(s)	756
BslI	CCNNNNNNNGG	3 cut(s)	377, 683, 764
BsmAI	GTCTC	1 cut(s)	727
BsmFI	GGGAC	1 cut(s)	756
BsnI	GGCC	3 cut(s)	709, 729, 850
Bso31I	GGTCTC	1 cut(s)	727
Bsp1286I	GDGCHC	2 cut(s)	283, 784
BspACI	CCGC	6 cut(s)	339, 384, 390, 716, 758, 809
BspANI	GGCC	3 cut(s)	709, 729, 850
BspDI	ATCGAT	1 cut(s)	564
BspLI	GGNNCC	2 cut(s)	382, 845
BspMAI	CTGCAG	1 cut(s)	119
BspPI	GGATC	7 cut(s)	15, 483, 757, 917, 985, 1004, 1031
BspT107I	GGYRCC	1 cut(s)	380
BspTI	CTTAAG	1 cut(s)	1015
BspTNI	GGTCTC	1 cut(s)	727
BsrDI	GCAATG	3 cut(s)	211, 492, 627
BsrFI	RCCGGY	1 cut(s)	943
BsrI	ACTGG	4 cut(s)	100, 607, 921, 1040
BssAI	RCCGGY	1 cut(s)	943
BssECI	CCNNGG	2 cut(s)	804, 926
BssSI	CACGAG	3 cut(s)	33, 248, 874
BssT1I	CCWWGG	1 cut(s)	926
Bst2BI	CACGAG	3 cut(s)	33, 248, 874
Bst4CI	ACNGT	5 cut(s)	72, 167, 346, 652, 984
BstAFI	CTTAAG	1 cut(s)	1015
BstBAI	YACGTR	1 cut(s)	952
BstC8I	GCNNGC	1 cut(s)	1062
BstDEI	CTNAG	2 cut(s)	11, 1065
BstDSI	CCRYGG	1 cut(s)	804
BstF5I	GGATG	2 cut(s)	126, 367
BstH2I	RGCGCY	1 cut(s)	815
BstHHI	GCGC	2 cut(s)	204, 814
BstMAI	GTCTC	1 cut(s)	727
BstMCI	CGRYCG	4 cut(s)	710, 730, 851, 944
BstMWI	GCNNNNNNNGC	1 cut(s)	389
BstNSI	RCATGY	2 cut(s)	279, 1064
BstSCI	CCNGG	2 cut(s)	682, 845
BstSFI	CTRYAG	2 cut(s)	115, 424
BstV1I	GCAGC	8 cut(s)	75, 101, 165, 362, 373, 537, 801, 839
BstV2I	GAAGAC	1 cut(s)	632
BstX2I	RGATCY	1 cut(s)	7
BstYI	RGATCY	1 cut(s)	7
BstZI	CGGCCG	3 cut(s)	707, 727, 848
Bsu15I	ATCGAT	1 cut(s)	564
BsuRI	GGCC	3 cut(s)	709, 729, 850
BsuTUI	ATCGAT	1 cut(s)	564
BtgI	CCRYGG	1 cut(s)	804
BtsCI	GGATG	2 cut(s)	126, 367
BtsI	GCAGTG	1 cut(s)	315
BtsIMutI	CAGTG	6 cut(s)	163, 315, 342, 600, 914, 980
Cac8I	GCNNGC	1 cut(s)	1062
CfoI	GCGC	2 cut(s)	204, 814
Cfr10I	RCCGGY	1 cut(s)	943
Cfr13I	GGNCC	1 cut(s)	843
ClaI	ATCGAT	1 cut(s)	564
Csp6I	GTAC	2 cut(s)	73, 211
CspAI	ACCGGT	1 cut(s)	943
CviAII	CATG	5 cut(s)	266, 276, 376, 458, 1061
CviQI	GTAC	2 cut(s)	73, 211
DdeI	CTNAG	2 cut(s)	11, 1065
EaeI	YGGCCR	3 cut(s)	707, 727, 848
EagI	CGGCCG	3 cut(s)	707, 727, 848
EciI	GGCGGA	1 cut(s)	747
EclXI	CGGCCG	3 cut(s)	707, 727, 848
Eco130I	CCWWGG	1 cut(s)	926
Eco31I	GGTCTC	1 cut(s)	727
Eco47I	GGWCC	1 cut(s)	843
Eco52I	CGGCCG	3 cut(s)	707, 727, 848
Eco57I	CTGAAG	2 cut(s)	158, 866
EcoT14I	CCWWGG	1 cut(s)	926
ErhI	CCWWGG	1 cut(s)	926
FaeI	CATG	5 cut(s)	269, 279, 379, 461, 1064
FaiI	YATR	9 cut(s)	45, 267, 277, 359, 377, 395, 459, 1046, 1062
FaqI	GGGAC	1 cut(s)	756
FatI	CATG	5 cut(s)	265, 275, 375, 457, 1060
FblI	GTMKAC	1 cut(s)	406
FokI	GGATG	2 cut(s)	133, 354
FspI	TGCGCA	1 cut(s)	203
GlaI	GCGC	2 cut(s)	203, 813
GsaI	CCCAGC	1 cut(s)	524
GsuI	CTGGAG	2 cut(s)	117, 624
HaeII	RGCGCY	1 cut(s)	815
HaeIII	GGCC	3 cut(s)	709, 729, 850
HapII	CCGG	7 cut(s)	684, 706, 726, 847, 851, 866, 944
HhaI	GCGC	2 cut(s)	204, 814
Hin1II	CATG	5 cut(s)	269, 279, 379, 461, 1064
Hin6I	GCGC	2 cut(s)	202, 812
HinP1I	GCGC	2 cut(s)	202, 812
HincII	GTYRAC	1 cut(s)	407
HindII	GTYRAC	1 cut(s)	407
HindIII	AAGCTT	1 cut(s)	1018
HinfI	GANTC	5 cut(s)	26, 99, 194, 566, 795
HpaII	CCGG	7 cut(s)	684, 706, 726, 847, 851, 866, 944
Hpy166II	GTNNAC	4 cut(s)	407, 949, 987, 1054
Hpy188I	TCNGA	9 cut(s)	12, 104, 157, 235, 693, 843, 905, 972, 1030
Hpy188III	TCNNGA	7 cut(s)	35, 148, 284, 432, 574, 742, 988
Hpy8I	GTNNAC	4 cut(s)	407, 949, 987, 1054
Hpy99I	CGWCG	1 cut(s)	408
HpyAV	CCTTC	1 cut(s)	485
HpyCH4III	ACNGT	5 cut(s)	72, 167, 346, 652, 984
HpyCH4IV	ACGT	2 cut(s)	271, 951
HpyCH4V	TGCA	5 cut(s)	117, 242, 275, 817, 827
HpyF10VI	GCNNNNNNNGC	1 cut(s)	389
HpyF3I	CTNAG	2 cut(s)	11, 1065
HpySE526I	ACGT	2 cut(s)	271, 951
Hsp92II	CATG	5 cut(s)	269, 279, 379, 461, 1064
HspAI	GCGC	2 cut(s)	202, 812
LmnI	GCTCC	3 cut(s)	262, 517, 590
Lsp1109I	GCAGC	8 cut(s)	75, 101, 165, 362, 373, 537, 801, 839
MaeII	ACGT	2 cut(s)	271, 951
MboII	GAAGA	4 cut(s)	151, 458, 637, 790
MflI	RGATCY	1 cut(s)	7
MhlI	GDGCHC	2 cut(s)	283, 784
MluCI	AATT	5 cut(s)	47, 229, 462, 594, 991
MlyI	GAGTC	2 cut(s)	35, 108
MmeI	TCCRAC	2 cut(s)	82, 716
MnlI	CCTC	8 cut(s)	98, 163, 436, 580, 765, 784, 883, 991
MroXI	GAANNNNTTC	1 cut(s)	660
MseI	TTAA	5 cut(s)	513, 531, 597, 633, 1016
MslI	CAYNNNNRTG	2 cut(s)	270, 1059
MspA1I	CMGCKG	1 cut(s)	386
MspCI	CTTAAG	1 cut(s)	1015
MspI	CCGG	7 cut(s)	684, 706, 726, 847, 851, 866, 944
MspR9I	CCNGG	2 cut(s)	684, 847
MwoI	GCNNNNNNNGC	1 cut(s)	389
NciI	CCSGG	2 cut(s)	684, 847
NlaIII	CATG	5 cut(s)	269, 279, 379, 461, 1064
NlaIV	GGNNCC	2 cut(s)	382, 845
NsbI	TGCGCA	1 cut(s)	203
NspI	RCATGY	2 cut(s)	279, 1064
PaeI	GCATGC	1 cut(s)	1064
PcsI	WCGNNNNNNNCGW	3 cut(s)	189, 670, 758
PdmI	GAANNNNTTC	1 cut(s)	660
PfeI	GAWTC	3 cut(s)	194, 566, 795
PinAI	ACCGGT	1 cut(s)	943
PleI	GAGTC	2 cut(s)	34, 107
PpsI	GAGTC	2 cut(s)	34, 107
Ppu21I	YACGTR	1 cut(s)	952
PspFI	CCCAGC	1 cut(s)	520
PspN4I	GGNNCC	2 cut(s)	382, 845
PspPI	GGNCC	1 cut(s)	843
PstI	CTGCAG	1 cut(s)	119
PsuI	RGATCY	1 cut(s)	7
RsaI	GTAC	2 cut(s)	74, 212
RsaNI	GTAC	2 cut(s)	73, 211
RseI	CAYNNNNRTG	2 cut(s)	270, 1059
SalI	GTCGAC	1 cut(s)	405
SaqAI	TTAA	5 cut(s)	513, 531, 597, 633, 1016
Sau96I	GGNCC	1 cut(s)	843
ScaI	AGTACT	1 cut(s)	74
SchI	GAGTC	2 cut(s)	35, 108
ScrFI	CCNGG	2 cut(s)	684, 847
SduI	GDGCHC	2 cut(s)	283, 784
SfcI	CTRYAG	2 cut(s)	115, 424
SinI	GGWCC	1 cut(s)	843
SmiMI	CAYNNNNRTG	2 cut(s)	270, 1059
SmlI	CTYRAG	4 cut(s)	146, 430, 574, 1015
SmoI	CTYRAG	4 cut(s)	146, 430, 574, 1015
SphI	GCATGC	1 cut(s)	1064
Sse9I	AATT	5 cut(s)	47, 229, 462, 594, 991
SsiI	CCGC	6 cut(s)	339, 384, 390, 716, 758, 809
StyD4I	CCNGG	2 cut(s)	682, 845
StyI	CCWWGG	1 cut(s)	926
TaaI	ACNGT	5 cut(s)	72, 167, 346, 652, 984
TaiI	ACGT	2 cut(s)	274, 954
TasI	AATT	5 cut(s)	47, 229, 462, 594, 991
TatI	WGTACW	1 cut(s)	72
TauI	GCSGC	4 cut(s)	342, 386, 392, 812
TfiI	GAWTC	3 cut(s)	194, 566, 795
Tru1I	TTAA	5 cut(s)	513, 531, 597, 633, 1016
Tru9I	TTAA	5 cut(s)	513, 531, 597, 633, 1016
TscAI	CASTG	6 cut(s)	170, 322, 349, 607, 921, 987
TseI	GCWGC	8 cut(s)	88, 114, 178, 350, 386, 525, 814, 827
TspDTI	ATGAA	5 cut(s)	282, 364, 474, 638, 1061
TspGWI	ACGGA	1 cut(s)	20
TspRI	CASTG	6 cut(s)	170, 322, 349, 607, 921, 987
Vha464I	CTTAAG	1 cut(s)	1015
VpaK11BI	GGWCC	1 cut(s)	843
XapI	RAATTY	2 cut(s)	47, 229
XceI	RCATGY	2 cut(s)	279, 1064
XmiI	GTMKAC	1 cut(s)	406
XmnI	GAANNNNTTC	1 cut(s)	660
ZrmI	AGTACT	1 cut(s)	74

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.