Rmu_sc0007280.1_g000003

UPF0496 protein At4g34320-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0007280.1
OG0017240
Physical Location & Seq
Forward (+)
13962 .. 14678
717 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0007280.1_g000003.1.cds

Sequence Viewer

Length: 717 bp
atgacggaactgagtaagttcgtagagtcagctcgtgaaaatcataaatttattcaatctgttgttcaacagtactttgacaacgggctgccaactggagtcggaggaagtcgctgcaggatgattttggagaaactgaagaagctcaagacctctgatgaccattgtgctgaaaggctgctcgaacagatcgaatctttgcgcagtgagtacgaaaatacgctcgaaaattctgaagttgcaaaacacgagattgagatggagcatgaacatgcatgtgctctggaaaaacgaaaaacaaagaaaaataaacgcactgcgacaactttgctcatttgcggcactgtggcagctactatggttggtcatccacacataggtgccgctgctgctatggttgttcgtcgacaagtttctaaagcctgtagctcgagaactaaagaggaagaacaacgacatgaaattgctctcaaggctcactactcaatggaaggaaaaatgattgttagcattaaggagctgggtagcattaagtttctcattgataaggttgtaaatgagatcgattcactcttgagaagtgtagagggtgcaattaacactggagaagtagatttcgcaatgaagactattaagaataagatggaaacgtttcggaagcaaattgacgaattgaatacagaagcaggtaaatatatatatagtcgacctacataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF677

Protein Analysis

238

Amino Acids

26.94

Weight (kDa)

8.49

Isoelectric Point (pI)

49.87

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 203
Acc36I ACCTGC 1 cut(s) 677
AccB1I GGYRCC 1 cut(s) 380
AccI GTMKAC 2 cut(s) 406, 706
AciI CCGC 2 cut(s) 339, 384
AclI AACGTT 1 cut(s) 650
AcsI RAATTY 2 cut(s) 47, 229
AcuI CTGAAG 2 cut(s) 158, 255
AfaI GTAC 2 cut(s) 74, 212
AfiI CCNNNNNNNGG 1 cut(s) 377
AgsI TTSAA 3 cut(s) 56, 68, 676
AleI CACNNNNGTG 1 cut(s) 378
AluBI AGCT 5 cut(s) 32, 145, 353, 429, 520
AluI AGCT 5 cut(s) 32, 145, 353, 429, 520
Alw21I GWGCWC 1 cut(s) 283
Ama87I CYCGRG 1 cut(s) 430
ApeKI GCWGC 6 cut(s) 88, 114, 178, 350, 386, 389
ApoI RAATTY 2 cut(s) 47, 229
Asp700I GAANNNNTTC 1 cut(s) 651
AspLEI GCGC 1 cut(s) 204
AvaI CYCGRG 1 cut(s) 430
BanI GGYRCC 1 cut(s) 380
BauI CACGAG 2 cut(s) 33, 248
BbsI GAAGAC 1 cut(s) 632
Bbv12I GWGCWC 1 cut(s) 283
BbvI GCAGC 6 cut(s) 75, 101, 165, 362, 373, 376
BccI CCATC 2 cut(s) 253, 637
BcgI CGANNNNNNTGC 2 cut(s) 310, 344
BfmI CTRYAG 2 cut(s) 115, 424
BfuAI ACCTGC 1 cut(s) 677
BisI GCNGC 8 cut(s) 89, 115, 179, 340, 351, 384, 387, 390
BlsI GCNGC 8 cut(s) 90, 116, 180, 341, 352, 385, 388, 391
BmcAI AGTACT 1 cut(s) 74
BmeT110I CYCGRG 1 cut(s) 430
BmiI GGNNCC 1 cut(s) 382
BpiI GAAGAC 1 cut(s) 632
BpmI CTGGAG 2 cut(s) 117, 624
BpuEI CTTGAG 3 cut(s) 131, 455, 595
Bsa29I ATCGAT 1 cut(s) 564
Bsc4I CCNNNNNNNGG 1 cut(s) 377
Bse1I ACTGG 2 cut(s) 100, 607
Bse3DI GCAATG 1 cut(s) 627
BseCI ATCGAT 1 cut(s) 564
BseGI GGATG 2 cut(s) 126, 367
BseLI CCNNNNNNNGG 1 cut(s) 377
BseMI GCAATG 1 cut(s) 627
BseNI ACTGG 2 cut(s) 100, 607
BseXI GCAGC 6 cut(s) 75, 101, 165, 362, 373, 376
BseYI CCCAGC 1 cut(s) 520
BshNI GGYRCC 1 cut(s) 380
BshVI ATCGAT 1 cut(s) 564
BsiHKAI GWGCWC 1 cut(s) 283
BsiHKCI CYCGRG 1 cut(s) 430
BslI CCNNNNNNNGG 1 cut(s) 377
BsoBI CYCGRG 1 cut(s) 430
Bsp1286I GDGCHC 1 cut(s) 283
Bsp143I GATC 2 cut(s) 189, 561
BspACI CCGC 2 cut(s) 339, 384
BspDI ATCGAT 1 cut(s) 564
BspLI GGNNCC 1 cut(s) 382
BspMAI CTGCAG 1 cut(s) 119
BspMI ACCTGC 1 cut(s) 677
BspT107I GGYRCC 1 cut(s) 380
BsrDI GCAATG 1 cut(s) 627
BsrI ACTGG 2 cut(s) 100, 607
BssMI GATC 2 cut(s) 189, 561
BssSI CACGAG 2 cut(s) 33, 248
Bst2BI CACGAG 2 cut(s) 33, 248
Bst4CI ACNGT 2 cut(s) 72, 346
BstDEI CTNAG 1 cut(s) 11
BstF5I GGATG 2 cut(s) 126, 367
BstHHI GCGC 1 cut(s) 204
BstKTI GATC 2 cut(s) 192, 564
BstMBI GATC 2 cut(s) 189, 561
BstMWI GCNNNNNNNGC 2 cut(s) 389, 473
BstNSI RCATGY 2 cut(s) 275, 279
BstSFI CTRYAG 2 cut(s) 115, 424
BstV1I GCAGC 6 cut(s) 75, 101, 165, 362, 373, 376
BstV2I GAAGAC 1 cut(s) 632
Bsu15I ATCGAT 1 cut(s) 564
BsuTUI ATCGAT 1 cut(s) 564
BtsCI GGATG 2 cut(s) 126, 367
BtsI GCAGTG 2 cut(s) 211, 315
BtsIMutI CAGTG 4 cut(s) 211, 315, 342, 600
BveI ACCTGC 1 cut(s) 677
CfoI GCGC 1 cut(s) 204
ClaI ATCGAT 1 cut(s) 564
Csp6I GTAC 2 cut(s) 73, 211
CviAII CATG 4 cut(s) 266, 272, 276, 458
CviJI RGCY 9 cut(s) 32, 88, 145, 178, 353, 422, 429, 476, 520
CviKI_1 RGCY 9 cut(s) 32, 88, 145, 178, 353, 422, 429, 476, 520
CviQI GTAC 2 cut(s) 73, 211
DdeI CTNAG 1 cut(s) 11
DpnI GATC 2 cut(s) 191, 563
DpnII GATC 2 cut(s) 189, 561
Eco57I CTGAAG 2 cut(s) 158, 255
Eco88I CYCGRG 1 cut(s) 430
EcoT22I ATGCAT 1 cut(s) 277
FaeI CATG 4 cut(s) 269, 275, 279, 461
FatI CATG 4 cut(s) 265, 271, 275, 457
FblI GTMKAC 2 cut(s) 406, 706
Fnu4HI GCNGC 8 cut(s) 89, 115, 179, 340, 351, 384, 387, 390
FokI GGATG 2 cut(s) 133, 354
Fsp4HI GCNGC 8 cut(s) 89, 115, 179, 340, 351, 384, 387, 390
FspI TGCGCA 1 cut(s) 203
GlaI GCGC 1 cut(s) 203
GluI GCNGC 8 cut(s) 89, 115, 179, 340, 351, 384, 387, 390
GsaI CCCAGC 1 cut(s) 524
GsuI CTGGAG 2 cut(s) 117, 624
HhaI GCGC 1 cut(s) 204
Hin1II CATG 4 cut(s) 269, 275, 279, 461
Hin6I GCGC 1 cut(s) 202
HinP1I GCGC 1 cut(s) 202
HincII GTYRAC 2 cut(s) 407, 707
HindII GTYRAC 2 cut(s) 407, 707
HinfI GANTC 4 cut(s) 26, 99, 194, 566
Hpy166II GTNNAC 2 cut(s) 407, 707
Hpy188I TCNGA 4 cut(s) 104, 157, 235, 657
Hpy188III TCNNGA 5 cut(s) 35, 148, 284, 432, 574
Hpy8I GTNNAC 2 cut(s) 407, 707
Hpy99I CGWCG 1 cut(s) 408
HpyAV CCTTC 1 cut(s) 485
HpyCH4III ACNGT 2 cut(s) 72, 346
HpyCH4IV ACGT 1 cut(s) 650
HpyCH4V TGCA 4 cut(s) 117, 242, 275, 593
HpyF10VI GCNNNNNNNGC 2 cut(s) 389, 473
HpyF3I CTNAG 1 cut(s) 11
HpySE526I ACGT 1 cut(s) 650
Hsp92II CATG 4 cut(s) 269, 275, 279, 461
HspAI GCGC 1 cut(s) 202
Kzo9I GATC 2 cut(s) 189, 561
LmnI GCTCC 2 cut(s) 262, 517
LpnPI CCDG 7 cut(s) 81, 103, 269, 436, 506, 588, 672
Lsp1109I GCAGC 6 cut(s) 75, 101, 165, 362, 373, 376
MaeII ACGT 1 cut(s) 650
MalI GATC 2 cut(s) 191, 563
MboI GATC 2 cut(s) 189, 561
MboII GAAGA 3 cut(s) 151, 458, 637
MhlI GDGCHC 1 cut(s) 283
MluCI AATT 6 cut(s) 47, 229, 462, 594, 663, 671
MlyI GAGTC 2 cut(s) 35, 108
MmeI TCCRAC 1 cut(s) 82
MnlI CCTC 4 cut(s) 98, 163, 436, 580
Mph1103I ATGCAT 1 cut(s) 277
MroXI GAANNNNTTC 1 cut(s) 651
MseI TTAA 4 cut(s) 513, 531, 597, 633
MslI CAYNNNNRTG 3 cut(s) 270, 276, 378
MspA1I CMGCKG 1 cut(s) 386
MwoI GCNNNNNNNGC 2 cut(s) 389, 473
NdeII GATC 2 cut(s) 189, 561
NlaIII CATG 4 cut(s) 269, 275, 279, 461
NlaIV GGNNCC 1 cut(s) 382
NsbI TGCGCA 1 cut(s) 203
NsiI ATGCAT 1 cut(s) 277
NspI RCATGY 2 cut(s) 275, 279
OliI CACNNNNGTG 1 cut(s) 378
PaeR7I CTCGAG 1 cut(s) 430
PcsI WCGNNNNNNNCGW 1 cut(s) 189
PdmI GAANNNNTTC 1 cut(s) 651
PfeI GAWTC 2 cut(s) 194, 566
PkrI GCNGC 8 cut(s) 90, 116, 180, 341, 352, 385, 388, 391
PleI GAGTC 2 cut(s) 34, 107
PpsI GAGTC 2 cut(s) 34, 107
Psp1406I AACGTT 1 cut(s) 650
PspFI CCCAGC 1 cut(s) 520
PspN4I GGNNCC 1 cut(s) 382
PstI CTGCAG 1 cut(s) 119
RsaI GTAC 2 cut(s) 74, 212
RsaNI GTAC 2 cut(s) 73, 211
RseI CAYNNNNRTG 3 cut(s) 270, 276, 378
SalI GTCGAC 2 cut(s) 405, 705
SaqAI TTAA 4 cut(s) 513, 531, 597, 633
SatI GCNGC 8 cut(s) 89, 115, 179, 340, 351, 384, 387, 390
Sau3AI GATC 2 cut(s) 189, 561
ScaI AGTACT 1 cut(s) 74
SchI GAGTC 2 cut(s) 35, 108
SduI GDGCHC 1 cut(s) 283
SfcI CTRYAG 2 cut(s) 115, 424
Sfr274I CTCGAG 1 cut(s) 430
SlaI CTCGAG 1 cut(s) 430
SmiMI CAYNNNNRTG 3 cut(s) 270, 276, 378
SmlI CTYRAG 4 cut(s) 146, 430, 470, 574
SmoI CTYRAG 4 cut(s) 146, 430, 470, 574
Sse9I AATT 6 cut(s) 47, 229, 462, 594, 663, 671
SsiI CCGC 2 cut(s) 339, 384
TaaI ACNGT 2 cut(s) 72, 346
TaiI ACGT 1 cut(s) 653
TaqI TCGA 7 cut(s) 183, 192, 225, 406, 431, 564, 706
TasI AATT 6 cut(s) 47, 229, 462, 594, 663, 671
TatI WGTACW 1 cut(s) 72
TauI GCSGC 2 cut(s) 342, 386
TfiI GAWTC 2 cut(s) 194, 566
Tru1I TTAA 4 cut(s) 513, 531, 597, 633
Tru9I TTAA 4 cut(s) 513, 531, 597, 633
TscAI CASTG 4 cut(s) 211, 322, 349, 607
TseI GCWGC 6 cut(s) 88, 114, 178, 350, 386, 389
TspDTI ATGAA 3 cut(s) 282, 474, 638
TspGWI ACGGA 1 cut(s) 20
TspRI CASTG 4 cut(s) 211, 322, 349, 607
XapI RAATTY 2 cut(s) 47, 229
XceI RCATGY 2 cut(s) 275, 279
XhoI CTCGAG 1 cut(s) 430
XmiI GTMKAC 2 cut(s) 406, 706
XmnI GAANNNNTTC 1 cut(s) 651
ZrmI AGTACT 1 cut(s) 74
Zsp2I ATGCAT 1 cut(s) 277
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.