Rmu_sc0000776.1_g000006

receptor-like protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000776.1
OG0010976
Physical Location & Seq
Forward (+)
15674 .. 18247
2574 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 2574 bp
atgatggctatcctcctggtctttgtctatgcacttctctacaaccccaccattgtcctctctgacccttcccccaccaccttcaccccccaagacaacttcctcatcaactgcggtgctgcaagcgctcccacactacccgatggaaggaccttcaagactgattcacaatcatcgcaacatttgaaagcaaatgatgataacaaggtgtctgatgacaaggcagatgtgccttctcctctttacaaaaccgcaaggattttcacaagtgaagccacttatacgttccacatgggaagtcctgggtggcattgggttcgcctctatttctatcccattcaaaactctgtgtctgatcttcagaaggcaactttcaatgtcatgacagataagtacactttgctccatagcttcaatttcaacgaggccgctaacaacaacaccatcaaagttgttcgcaaggagtaccttctcaacgtgaccgagcagcaattctcgatcaagttctctccccagaagaactccgcggcattcatcaatgcaattgaggtggtttcagctcctgattatctcatctcagacacggctaacaaccttcagccagtgagccagttccaggggttgtccaaatttggatacgaatatatgtacaggattaacgtgggaggacctctagtgaccccggtcaatgacacattaggacggttctggttgccggacgagccatacattaagtccaagaacatggcccaaagtgccaaggttgaaaccaaaattatcaagtatcctcaagggctcacaccccaaatagctccaccaatagtttatgcaactgctgcgcatatggaagatgccggtgtcagcaatcaaaagttcaatgtgacatgggactttcaggctgaaaatgcatatggttacttgatccggttgcatttctgcgacattgtgagcaaaacacttggtaatctttacttcaatgtctacatcaatgggcagatggcaataagtgatttggatttatcacaaaccgtcaacggtttggcaattccattctacaaggacattgtggtcaactcttcattgataaaagacgtgctttcaatccagattggtccgtctaaattggggagtggtgctcaggatgccattctaaatggtttggaggttatgaaaataagcaattctgttaatagtttggatggagagttcggagtcgatggaaaagaatcaaaagatagcagcggaggtgttcacaagggagcggtggctgcagtcggatttggtttgatgtttggagcctttattggacttggggcaatggtgtacaaatggaagaagagacctcaagattggcagaaaaggaacagcttctcttcttggttacttcctgtacatgctggagacagcagttttatgtcaagcaagaactcagtgggaaagagcatgtactcttcctctatgggccttggccgattcttctctctcgcggagttacaggaagctaccaacaatttcgactcgaacaaaatcattggtgttggtggatttggcaatgtgtatcttggcgtgattgatgatgggattagtgttgctgtcaagagaggaaatccacaatctgaacaggggattacagagttccaaacagagattcaaatgttgtcaaagctcaggcacaggcatttggtctctctaattggctattgtgatgaaaaccaagagatgatcttggtttatgagttcatgtcaaatggaccattcagagatcatctgtatggtaagaacttggcaccactgtcatggaagcaaagactagagatctgcattggtgctgctcgcgggcttcactaccttcatacgggcacagcacaaggcatcattcaccgcgatgtgaagacaacaaacatccttctcgatgaccagttcactgccaaggttgctgatttcgggttgtctaaagatgcgccaatgggacagaaccatgtgagtaccgctgtgaagggaagctttgggtacttggatcctgagtactttaggaggcagcaactgacagacaaatccgatgtctactcattcggagttgtcatgctcgaggcattgtgtgctaggcctgctataaatccagcacttccaagagagcaagtcaacttggcagactggggaatgcagtggaagagaaaaggcttgctggaaaagatcgtcgaccctctcctcattggaaccatcaaccctgaatccatgaagaagtttggtgaggctgccgagaagtgcttgttagagcacggtgtggataggcctacgatgggagatgtgctgtggaacttggagtatgctctgcagcttcaagaggcattcaccgaaggaaagggcgaagatgacagcattaatgctaccccctccgctgatgctgcatctgcctctcctactgatgctgctgctgccgctcctactgctgctgcttccgttcctctcccggctgctatcctggaggaagaagccccccctacagaacagactatcaatgatcaatctggaactgctatattgtctcaattttctaacctcaatggtaggtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Malectin_like Pkinase_Tyr

Protein Analysis

857

Amino Acids

94.12

Weight (kDa)

5.61

Isoelectric Point (pI)

37.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Malectin PF11721 35 - 180 4.2e-10 Malectin domain
Malectin_like PF12819 36 - 392 1.2e-28 Malectin-like domain
Malectin PF11721 216 - 370 2.9e-09 Malectin domain
Pkinase PF00069 506 - 706 8.9e-42 Protein kinase domain
PK_Tyr_Ser-Thr PF07714 508 - 700 9.1e-45 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010976)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G21480 AT4G39110
fragaria_vesca FvH4_2g09700
malus_domestica MD05G1060800.v1.1 MD10G1068600.v1.1
prunus_persica Prupe.8G090600_v2.0.a1
pyrus_communis pycom10g05470
rosa_chinensis RchiOBHm_Chr6g0266011
rosa_laevigata RLG00000014135 RLG00000014136 RLG00000014138
rosa_multiflora Rmu_sc0000776.1_g000006
rosa_roxburghii Rroxscaffold_174G00435080 Rroxscaffold_7G00202100
rosa_rugosa Rorug06G0022500
rosa_samantha Rh6AG143700 Rh6BG144000 Rh6CG140700 Rh6DG128300
rosa_wichuraiana Rw6G012420

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 1067
Acc16I TGCGCA 1 cut(s) 840
AccB1I GGYRCC 1 cut(s) 1786
AccBSI CCGCTC 2 cut(s) 1262, 2441
AccI GTMKAC 3 cut(s) 981, 2064, 2199
AccII CGCG 4 cut(s) 527, 1487, 1836, 1884
AclWI GGATC 3 cut(s) 916, 2012, 2025
AcoI YGGCCR 1 cut(s) 1468
AcsI RAATTY 1 cut(s) 629
AcuI CTGAAG 2 cut(s) 344, 581
AdeI CACNNNGTG 1 cut(s) 2284
AfaI GTAC 9 cut(s) 395, 467, 650, 1325, 1392, 1448, 1987, 2012, 2027
AfeI AGCGCT 1 cut(s) 127
AfiI CCNNNNNNNGG 4 cut(s) 147, 616, 1855, 2300
AjiI CACGTC 1 cut(s) 1093
AjnI CCWGG 4 cut(s) 15, 301, 615, 2481
AjuI GAANNNNNNNTTGG 2 cut(s) 1632, 1664
AloI GAACNNNNNNTCC 2 cut(s) 1190, 1222
AluBI AGCT 8 cut(s) 411, 560, 812, 1368, 1502, 1666, 2004, 2338
AluI AGCT 8 cut(s) 411, 560, 812, 1368, 1502, 1666, 2004, 2338
Alw21I GWGCWC 2 cut(s) 1138, 2280
Alw26I GTCTC 4 cut(s) 1333, 1395, 1690, 2550
AlwI GGATC 3 cut(s) 916, 2012, 2025
AlwNI CAGNNNCTG 2 cut(s) 563, 2044
Ama87I CYCGRG 1 cut(s) 2087
Aor51HI AGCGCT 1 cut(s) 127
AoxI GGCC 6 cut(s) 426, 747, 1462, 1468, 2105, 2291
ApoI RAATTY 1 cut(s) 629
ArsI GACNNNNNNTTYG 2 cut(s) 2046, 2078
AseI ATTAAT 1 cut(s) 2382
Asp700I GAANNNNTTC 1 cut(s) 1367
AspLEI GCGC 3 cut(s) 128, 841, 1963
AspS9I GGNCC 6 cut(s) 150, 668, 748, 1112, 1462, 1751
AsuC2I CCSGG 2 cut(s) 683, 2471
AsuHPI GGTGA 4 cut(s) 76, 1871, 2261, 2344
AvaI CYCGRG 1 cut(s) 2087
AvaII GGWCC 4 cut(s) 150, 668, 1112, 1751
BaeGI GKGCMC 1 cut(s) 1862
BamHI GGATCC 1 cut(s) 2017
BanI GGYRCC 1 cut(s) 1786
BanII GRGCYC 1 cut(s) 798
BbsI GAAGAC 1 cut(s) 1898
Bbv12I GWGCWC 2 cut(s) 1138, 2280
BccI CCATC 8 cut(s) 137, 452, 991, 1193, 1211, 1571, 2228, 2293
BceAI ACGGC 1 cut(s) 600
BcgI CGANNNNNNTGC 2 cut(s) 299, 333
BciT130I CCWGG 4 cut(s) 17, 303, 617, 2483
BciVI GTATCC 2 cut(s) 629, 795
BclI TGATCA 1 cut(s) 2521
BcnI CCSGG 2 cut(s) 683, 2471
BcoDI GTCTC 4 cut(s) 1333, 1395, 1690, 2550
BfaI CTAG 3 cut(s) 674, 1811, 2103
BfmI CTRYAG 3 cut(s) 1269, 2333, 2502
BfoI RGCGCY 1 cut(s) 129
BfuI GTATCC 2 cut(s) 629, 795
BglII AGATCT 1 cut(s) 1815
BmcAI AGTACT 1 cut(s) 2027
Bme1390I CCNGG 6 cut(s) 17, 303, 617, 683, 2471, 2483
Bme18I GGWCC 4 cut(s) 150, 668, 1112, 1751
BmeT110I CYCGRG 1 cut(s) 2087
BmgBI CACGTC 1 cut(s) 1093
BmgT120I GGNCC 6 cut(s) 150, 668, 748, 1112, 1462, 1751
BmiI GGNNCC 4 cut(s) 1297, 1788, 2019, 2218
BmrFI CCNGG 6 cut(s) 17, 303, 617, 683, 2471, 2483
BmrI ACTGGG 1 cut(s) 2164
BmsI GCATC 7 cut(s) 841, 1132, 1881, 1948, 2392, 2416, 2417
BmuI ACTGGG 1 cut(s) 2164
BoxI GACNNNNGTC 1 cut(s) 683
BpiI GAAGAC 1 cut(s) 1898
BplI GAGNNNNNCTC 2 cut(s) 1120, 1152
BpmI CTGGAG 2 cut(s) 1419, 2504
Bpu10I CCTNAGC 2 cut(s) 1137, 1667
BpuEI CTTGAG 2 cut(s) 774, 1329
BpuMI CCSGG 2 cut(s) 683, 2471
BsaBI GATNNNNATC 1 cut(s) 8
BsaI GGTCTC 2 cut(s) 1333, 1690
BsaJI CCNNGG 7 cut(s) 302, 525, 616, 681, 759, 1465, 1929
BsaWI WCCGGW 1 cut(s) 924
Bsc4I CCNNNNNNNGG 4 cut(s) 147, 616, 1855, 2300
Bse118I RCCGGY 1 cut(s) 854
Bse1I ACTGG 4 cut(s) 602, 610, 1918, 2159
Bse3DI GCAATG 2 cut(s) 1323, 1558
Bse8I GATNNNNATC 1 cut(s) 8
BseBI CCWGG 4 cut(s) 17, 303, 617, 2483
BseDI CCNNGG 7 cut(s) 302, 525, 616, 681, 759, 1465, 1929
BseGI GGATG 3 cut(s) 1147, 1204, 1902
BseJI GATNNNNATC 1 cut(s) 8
BseLI CCNNNNNNNGG 4 cut(s) 147, 616, 1855, 2300
BseMI GCAATG 2 cut(s) 1323, 1558
BseMII CTCAG 5 cut(s) 591, 1151, 1443, 1681, 2013
BseNI ACTGG 4 cut(s) 602, 610, 1918, 2159
BseRI GAGGAG 2 cut(s) 228, 2198
BseSI GKGCMC 1 cut(s) 1862
Bsh1236I CGCG 4 cut(s) 527, 1487, 1836, 1884
BshFI GGCC 6 cut(s) 428, 749, 1464, 1470, 2107, 2293
BshNI GGYRCC 1 cut(s) 1786
BsiHKAI GWGCWC 2 cut(s) 1138, 2280
BsiHKCI CYCGRG 1 cut(s) 2087
BsiSI CCGG 5 cut(s) 683, 716, 855, 925, 2471
BslFI GGGAC 2 cut(s) 902, 1983
BslI CCNNNNNNNGG 4 cut(s) 147, 616, 1855, 2300
BsmAI GTCTC 4 cut(s) 1333, 1395, 1690, 2550
BsmFI GGGAC 2 cut(s) 902, 1983
BsmI GAATGC 3 cut(s) 530, 2166, 2348
BsnI GGCC 6 cut(s) 428, 749, 1464, 1470, 2107, 2293
Bso31I GGTCTC 2 cut(s) 1333, 1690
BsoBI CYCGRG 1 cut(s) 2087
Bsp1286I GDGCHC 4 cut(s) 798, 1138, 1862, 2280
Bsp1407I TGTACA 3 cut(s) 648, 1323, 1390
Bsp143I GATC 9 cut(s) 355, 498, 921, 1722, 1762, 1815, 2017, 2193, 2521
BspANI GGCC 6 cut(s) 428, 749, 1464, 1470, 2107, 2293
BspCNI CTCAG 5 cut(s) 590, 1150, 1442, 1680, 2014
BspFNI CGCG 4 cut(s) 527, 1487, 1836, 1884
BspHI TCATGA 1 cut(s) 381
BspLI GGNNCC 4 cut(s) 1297, 1788, 2019, 2218
BspMAI CTGCAG 2 cut(s) 1273, 2337
BspPI GGATC 3 cut(s) 916, 2012, 2025
BspT107I GGYRCC 1 cut(s) 1786
BspTNI GGTCTC 2 cut(s) 1333, 1690
BsrBI CCGCTC 2 cut(s) 1262, 2441
BsrDI GCAATG 2 cut(s) 1323, 1558
BsrFI RCCGGY 1 cut(s) 854
BsrGI TGTACA 3 cut(s) 648, 1323, 1390
BsrI ACTGG 4 cut(s) 602, 610, 1918, 2159
BssAI RCCGGY 1 cut(s) 854
BssECI CCNNGG 7 cut(s) 302, 525, 616, 681, 759, 1465, 1929
BssMI GATC 9 cut(s) 355, 498, 921, 1722, 1762, 1815, 2017, 2193, 2521
BssT1I CCWWGG 3 cut(s) 759, 1465, 1929
Bst2UI CCWGG 4 cut(s) 17, 303, 617, 2483
Bst4CI ACNGT 5 cut(s) 705, 1030, 1037, 1794, 2282
Bst6I CTCTTC 5 cut(s) 1081, 1331, 1378, 1456, 2165
BstAPI GCANNNNNTGC 2 cut(s) 836, 2099
BstAUI TGTACA 3 cut(s) 648, 1323, 1390
BstC8I GCNNGC 5 cut(s) 124, 1834, 1838, 2109, 2183
BstDEI CTNAG 5 cut(s) 577, 1137, 1429, 1667, 2022
BstDSI CCRYGG 1 cut(s) 525
BstF5I GGATG 3 cut(s) 1147, 1204, 1902
BstFNI CGCG 4 cut(s) 527, 1487, 1836, 1884
BstH2I RGCGCY 1 cut(s) 129
BstHHI GCGC 3 cut(s) 128, 841, 1963
BstKTI GATC 9 cut(s) 358, 501, 924, 1725, 1765, 1818, 2020, 2196, 2524
BstMAI GTCTC 4 cut(s) 1333, 1395, 1690, 2550
BstMBI GATC 9 cut(s) 355, 498, 921, 1722, 1762, 1815, 2017, 2193, 2521
BstNI CCWGG 4 cut(s) 17, 303, 617, 2483
BstNSI RCATGY 2 cut(s) 1397, 1447
BstPAI GACNNNNGTC 1 cut(s) 683
BstSCI CCNGG 6 cut(s) 15, 301, 615, 681, 2469, 2481
BstSFI CTRYAG 3 cut(s) 1269, 2333, 2502
BstSLI GKGCMC 1 cut(s) 1862
BstUI CGCG 4 cut(s) 527, 1487, 1836, 1884
BstV2I GAAGAC 1 cut(s) 1898
BstX2I RGATCY 2 cut(s) 1815, 2017
BstXI CCANNNNNNTGG 2 cut(s) 745, 1797
BstYI RGATCY 2 cut(s) 1815, 2017
BsuI GTATCC 2 cut(s) 629, 795
BsuRI GGCC 6 cut(s) 428, 749, 1464, 1470, 2107, 2293
BtgI CCRYGG 1 cut(s) 525
BtgZI GCGATG 2 cut(s) 159, 1899
BtrI CACGTC 1 cut(s) 1093
BtsCI GGATG 3 cut(s) 1147, 1204, 1902
BtsI GCAGTG 2 cut(s) 1923, 2171
BtsIMutI CAGTG 5 cut(s) 609, 1437, 1790, 1923, 2171
Cac8I GCNNGC 5 cut(s) 124, 1834, 1838, 2109, 2183
CaiI CAGNNNCTG 2 cut(s) 563, 2044
CciI TCATGA 1 cut(s) 381
CfoI GCGC 3 cut(s) 128, 841, 1963
Cfr10I RCCGGY 1 cut(s) 854
Cfr13I GGNCC 6 cut(s) 150, 668, 748, 1112, 1462, 1751
Cfr42I CCGCGG 1 cut(s) 528
Csp6I GTAC 9 cut(s) 394, 466, 649, 1324, 1391, 1447, 1986, 2011, 2026
CspCI CAANNNNNGTGG 2 cut(s) 531, 566
CviQI GTAC 9 cut(s) 394, 466, 649, 1324, 1391, 1447, 1986, 2011, 2026
DdeI CTNAG 5 cut(s) 577, 1137, 1429, 1667, 2022
DpnI GATC 9 cut(s) 357, 500, 923, 1724, 1764, 1817, 2019, 2195, 2523
DpnII GATC 9 cut(s) 355, 498, 921, 1722, 1762, 1815, 2017, 2193, 2521
DraIII CACNNNGTG 1 cut(s) 2284
DrdI GACNNNNNNGTC 1 cut(s) 1067
DseDI GACNNNNNNGTC 1 cut(s) 1067
EaeI YGGCCR 1 cut(s) 1468
Eam1104I CTCTTC 5 cut(s) 1081, 1331, 1378, 1456, 2165
EarI CTCTTC 5 cut(s) 1081, 1331, 1378, 1456, 2165
Eco130I CCWWGG 3 cut(s) 759, 1465, 1929
Eco147I AGGCCT 2 cut(s) 2107, 2293
Eco24I GRGCYC 1 cut(s) 798
Eco31I GGTCTC 2 cut(s) 1333, 1690
Eco47I GGWCC 4 cut(s) 150, 668, 1112, 1751
Eco47III AGCGCT 1 cut(s) 127
Eco57I CTGAAG 2 cut(s) 344, 581
Eco88I CYCGRG 1 cut(s) 2087
EcoO109I RGGNCCY 2 cut(s) 150, 668
EcoRII CCWGG 4 cut(s) 15, 301, 615, 2481
EcoT14I CCWWGG 3 cut(s) 759, 1465, 1929
EcoT22I ATGCAT 1 cut(s) 910
EcoT38I GRGCYC 1 cut(s) 798
ErhI CCWWGG 3 cut(s) 759, 1465, 1929
FalI AAGNNNNNCTT 4 cut(s) 1080, 1112, 1988, 2020
FaqI GGGAC 2 cut(s) 902, 1983
FauI CCCGC 1 cut(s) 1829
FauNDI CATATG 2 cut(s) 843, 910
FbaI TGATCA 1 cut(s) 2521
FblI GTMKAC 3 cut(s) 981, 2064, 2199
FokI GGATG 3 cut(s) 1154, 1211, 1889
FriOI GRGCYC 1 cut(s) 798
FspBI CTAG 3 cut(s) 674, 1811, 2103
FspI TGCGCA 1 cut(s) 840
GlaI GCGC 3 cut(s) 127, 840, 1962
GsuI CTGGAG 2 cut(s) 1419, 2504
HaeII RGCGCY 1 cut(s) 129
HaeIII GGCC 6 cut(s) 428, 749, 1464, 1470, 2107, 2293
HapII CCGG 5 cut(s) 683, 716, 855, 925, 2471
HhaI GCGC 3 cut(s) 128, 841, 1963
Hin6I GCGC 3 cut(s) 126, 839, 1961
HinP1I GCGC 3 cut(s) 126, 839, 1961
HincII GTYRAC 4 cut(s) 1033, 1072, 2143, 2200
HindII GTYRAC 4 cut(s) 1033, 1072, 2143, 2200
HindIII AAGCTT 1 cut(s) 2002
HinfI GANTC 7 cut(s) 164, 1212, 1226, 1473, 1517, 1648, 2231
HpaII CCGG 5 cut(s) 683, 716, 855, 925, 2471
HphI GGTGA 4 cut(s) 76, 1871, 2261, 2344
Hpy99I CGWCG 1 cut(s) 2201
HpyCH4III ACNGT 5 cut(s) 705, 1030, 1037, 1794, 2282
HpyCH4IV ACGT 4 cut(s) 284, 477, 660, 1092
HpyF3I CTNAG 5 cut(s) 577, 1137, 1429, 1667, 2022
HpySE526I ACGT 4 cut(s) 284, 477, 660, 1092
HspAI GCGC 3 cut(s) 126, 839, 1961
Ksp22I TGATCA 1 cut(s) 2521
KspI CCGCGG 1 cut(s) 528
Kzo9I GATC 9 cut(s) 355, 498, 921, 1722, 1762, 1815, 2017, 2193, 2521
LmnI GCTCC 7 cut(s) 133, 408, 565, 817, 1259, 1295, 2446
LweI GCATC 7 cut(s) 841, 1132, 1881, 1948, 2392, 2416, 2417
MaeI CTAG 3 cut(s) 674, 1811, 2103
MaeII ACGT 4 cut(s) 284, 477, 660, 1092
MaeIII GTNAC 6 cut(s) 478, 676, 880, 914, 1380, 1491
MalI GATC 9 cut(s) 357, 500, 923, 1724, 1764, 1817, 2019, 2195, 2523
MbiI CCGCTC 2 cut(s) 1262, 2441
MboI GATC 9 cut(s) 355, 498, 921, 1722, 1762, 1815, 2017, 2193, 2521
MfeI CAATTG 1 cut(s) 543
MflI RGATCY 2 cut(s) 1815, 2017
MhlI GDGCHC 4 cut(s) 798, 1138, 1862, 2280
MlyI GAGTC 2 cut(s) 1221, 1511
MmeI TCCRAC 1 cut(s) 1255
Mph1103I ATGCAT 1 cut(s) 910
MroXI GAANNNNTTC 1 cut(s) 1367
MseI TTAA 4 cut(s) 657, 732, 1188, 2382
MslI CAYNNNNRTG 3 cut(s) 1770, 1795, 1884
MspA1I CMGCKG 4 cut(s) 527, 1242, 1991, 2399
MspI CCGG 5 cut(s) 683, 716, 855, 925, 2471
MspR9I CCNGG 6 cut(s) 17, 303, 617, 683, 2471, 2483
MunI CAATTG 1 cut(s) 543
Mva1269I GAATGC 3 cut(s) 530, 2166, 2348
MvaI CCWGG 4 cut(s) 17, 303, 617, 2483
MvnI CGCG 4 cut(s) 527, 1487, 1836, 1884
NciI CCSGG 2 cut(s) 683, 2471
NdeI CATATG 2 cut(s) 843, 910
NdeII GATC 9 cut(s) 355, 498, 921, 1722, 1762, 1815, 2017, 2193, 2521
NlaIV GGNNCC 4 cut(s) 1297, 1788, 2019, 2218
NmeAIII GCCGAG 1 cut(s) 2284
NmuCI GTSAC 3 cut(s) 478, 676, 880
NsbI TGCGCA 1 cut(s) 840
NsiI ATGCAT 1 cut(s) 910
NspI RCATGY 2 cut(s) 1397, 1447
PaeR7I CTCGAG 1 cut(s) 2087
PagI TCATGA 1 cut(s) 381
PceI AGGCCT 2 cut(s) 2107, 2293
PctI GAATGC 3 cut(s) 530, 2166, 2348
PdmI GAANNNNTTC 1 cut(s) 1367
PfeI GAWTC 5 cut(s) 164, 1226, 1473, 1648, 2231
PfoI TCCNGGA 1 cut(s) 2481
PleI GAGTC 2 cut(s) 1220, 1511
PpsI GAGTC 2 cut(s) 1220, 1511
PpuMI RGGWCCY 2 cut(s) 150, 668
PshAI GACNNNNGTC 1 cut(s) 683
PshBI ATTAAT 1 cut(s) 2382
Psp5II RGGWCCY 2 cut(s) 150, 668
Psp6I CCWGG 4 cut(s) 15, 301, 615, 2481
PspGI CCWGG 4 cut(s) 15, 301, 615, 2481
PspN4I GGNNCC 4 cut(s) 1297, 1788, 2019, 2218
PspPI GGNCC 6 cut(s) 150, 668, 748, 1112, 1462, 1751
PspPPI RGGWCCY 2 cut(s) 150, 668
PspXI VCTCGAGB 1 cut(s) 2087
PstI CTGCAG 2 cut(s) 1273, 2337
PstNI CAGNNNCTG 2 cut(s) 563, 2044
PsuI RGATCY 2 cut(s) 1815, 2017
RsaI GTAC 9 cut(s) 395, 467, 650, 1325, 1392, 1448, 1987, 2012, 2027
RsaNI GTAC 9 cut(s) 394, 466, 649, 1324, 1391, 1447, 1986, 2011, 2026
RseI CAYNNNNRTG 3 cut(s) 1770, 1795, 1884
SacII CCGCGG 1 cut(s) 528
SalI GTCGAC 1 cut(s) 2198
SaqAI TTAA 4 cut(s) 657, 732, 1188, 2382
Sau3AI GATC 9 cut(s) 355, 498, 921, 1722, 1762, 1815, 2017, 2193, 2521
Sau96I GGNCC 6 cut(s) 150, 668, 748, 1112, 1462, 1751
ScaI AGTACT 1 cut(s) 2027
SchI GAGTC 2 cut(s) 1221, 1511
ScrFI CCNGG 6 cut(s) 17, 303, 617, 683, 2471, 2483
SduI GDGCHC 4 cut(s) 798, 1138, 1862, 2280
SfaNI GCATC 7 cut(s) 841, 1132, 1881, 1948, 2392, 2416, 2417
SfcI CTRYAG 3 cut(s) 1269, 2333, 2502
Sfr274I CTCGAG 1 cut(s) 2087
Sfr303I CCGCGG 1 cut(s) 528
SgrBI CCGCGG 1 cut(s) 528
SinI GGWCC 4 cut(s) 150, 668, 1112, 1751
SlaI CTCGAG 1 cut(s) 2087
SmiMI CAYNNNNRTG 3 cut(s) 1770, 1795, 1884
SmlI CTYRAG 3 cut(s) 789, 1344, 2087
SmoI CTYRAG 3 cut(s) 789, 1344, 2087
SseBI AGGCCT 2 cut(s) 2107, 2293
SspMI CTAG 3 cut(s) 674, 1811, 2103
StuI AGGCCT 2 cut(s) 2107, 2293
StyD4I CCNGG 6 cut(s) 15, 301, 615, 681, 2469, 2481
StyI CCWWGG 3 cut(s) 759, 1465, 1929
TaaI ACNGT 5 cut(s) 705, 1030, 1037, 1794, 2282
TaiI ACGT 4 cut(s) 287, 480, 663, 1095
TaqI TCGA 7 cut(s) 497, 1215, 1515, 1520, 1911, 2088, 2199
TaqII GACCGA 1 cut(s) 497
TatI WGTACW 6 cut(s) 393, 648, 1323, 1390, 1446, 2025
TauI GCSGC 3 cut(s) 431, 530, 2441
TfiI GAWTC 5 cut(s) 164, 1226, 1473, 1648, 2231
Tru1I TTAA 4 cut(s) 657, 732, 1188, 2382
Tru9I TTAA 4 cut(s) 657, 732, 1188, 2382
TscAI CASTG 5 cut(s) 609, 1437, 1797, 1930, 2171
TseFI GTSAC 3 cut(s) 478, 676, 880
Tsp45I GTSAC 3 cut(s) 478, 676, 880
TspDTI ATGAA 7 cut(s) 523, 1068, 1184, 1722, 1729, 1841, 2252
TspGWI ACGGA 2 cut(s) 1104, 2449
TspRI CASTG 5 cut(s) 609, 1437, 1797, 1930, 2171
VpaK11BI GGWCC 4 cut(s) 150, 668, 1112, 1751
VspI ATTAAT 1 cut(s) 2382
XapI RAATTY 1 cut(s) 629
XceI RCATGY 2 cut(s) 1397, 1447
XhoI CTCGAG 1 cut(s) 2087
XmiI GTMKAC 3 cut(s) 981, 2064, 2199
XmnI GAANNNNTTC 1 cut(s) 1367
XspI CTAG 3 cut(s) 674, 1811, 2103
ZrmI AGTACT 1 cut(s) 2027
Zsp2I ATGCAT 1 cut(s) 910
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.