Rmu_sc0000923.1_g000004

receptor-like protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000923.1
Physical Location & Seq
Forward (+)
19029 .. 19514
486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000923.1_g000004.1.cds

Sequence Viewer

Length: 486 bp
atgcttgatgggaatattccatcatctctgttttctctgcccttgctctatagtctagatctttccaacaaccgattctctggtcaattccatgaaatttctaatttctcttcctgctttctggaatttcttgttctgcgtagcaatgatttggaaggggaaataccaatgtctatacataacatccgaggacttcagagtctcgcactcgagtcaaacaagttgaatggtacatttgctatcaatagtcttcatcagttcagaaatctttcttatcttgacctttcatacaacagcctgttgcttagtcttgatgctaccaacttctcgcattcctcctttccccagtttagagtcttgaggttggcttcagggaagttgagaagtccattcccagagtttttgagaaatcaatccaaattggagcatttggacctctcagacacctacatacatggcaggtatatcgatttgggggctcagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

161

Amino Acids

18.29

Weight (kDa)

6.03

Isoelectric Point (pI)

49.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 198
Acc36I ACCTGC 1 cut(s) 450
AcsI RAATTY 2 cut(s) 96, 125
AcuI CTGAAG 2 cut(s) 179, 354
AfaI GTAC 1 cut(s) 232
AgsI TTSAA 1 cut(s) 226
AjuI GAANNNNNNNTTGG 2 cut(s) 59, 91
Alw26I GTCTC 1 cut(s) 206
Ama87I CYCGRG 1 cut(s) 209
ApoI RAATTY 2 cut(s) 96, 125
Asp700I GAANNNNTTC 1 cut(s) 268
AspS9I GGNCC 1 cut(s) 433
AvaI CYCGRG 1 cut(s) 209
AvaII GGWCC 1 cut(s) 433
BanII GRGCYC 1 cut(s) 481
BarI GAAGNNNNNNTAC 2 cut(s) 147, 179
BbsI GAAGAC 1 cut(s) 242
BccI CCATC 2 cut(s) 2, 28
BcgI CGANNNNNNTGC 2 cut(s) 448, 482
BcoDI GTCTC 1 cut(s) 206
BfaI CTAG 1 cut(s) 56
BfmI CTRYAG 1 cut(s) 49
BfuAI ACCTGC 1 cut(s) 450
BglII AGATCT 1 cut(s) 58
Bme18I GGWCC 1 cut(s) 433
BmeT110I CYCGRG 1 cut(s) 209
BmgT120I GGNCC 1 cut(s) 433
BmrI ACTGGG 1 cut(s) 340
BmsI GCATC 1 cut(s) 304
BmuI ACTGGG 1 cut(s) 340
BpiI GAAGAC 1 cut(s) 242
BpuEI CTTGAG 1 cut(s) 379
Bsa29I ATCGAT 1 cut(s) 468
BsaJI CCNNGG 1 cut(s) 187
Bse1I ACTGG 1 cut(s) 346
Bse3DI GCAATG 1 cut(s) 151
BseCI ATCGAT 1 cut(s) 468
BseDI CCNNGG 1 cut(s) 187
BseGI GGATG 1 cut(s) 183
BseMI GCAATG 1 cut(s) 151
BseMII CTCAG 1 cut(s) 453
BseNI ACTGG 1 cut(s) 346
BshVI ATCGAT 1 cut(s) 468
BsiHKCI CYCGRG 1 cut(s) 209
BsmAI GTCTC 1 cut(s) 206
BsmI GAATGC 1 cut(s) 331
BsoBI CYCGRG 1 cut(s) 209
Bsp1286I GDGCHC 1 cut(s) 481
Bsp143I GATC 1 cut(s) 58
BspCNI CTCAG 1 cut(s) 452
BspDI ATCGAT 1 cut(s) 468
BspMI ACCTGC 1 cut(s) 450
BsrDI GCAATG 1 cut(s) 151
BsrI ACTGG 1 cut(s) 346
BssECI CCNNGG 1 cut(s) 187
BssMI GATC 1 cut(s) 58
Bst6I CTCTTC 1 cut(s) 115
BstDEI CTNAG 3 cut(s) 305, 439, 480
BstF5I GGATG 1 cut(s) 183
BstKTI GATC 1 cut(s) 61
BstMAI GTCTC 1 cut(s) 206
BstMBI GATC 1 cut(s) 58
BstSFI CTRYAG 1 cut(s) 49
BstV2I GAAGAC 1 cut(s) 242
BstX2I RGATCY 1 cut(s) 58
BstYI RGATCY 1 cut(s) 58
Bsu15I ATCGAT 1 cut(s) 468
BsuTUI ATCGAT 1 cut(s) 468
BtsCI GGATG 1 cut(s) 183
BveI ACCTGC 1 cut(s) 450
Cfr13I GGNCC 1 cut(s) 433
ClaI ATCGAT 1 cut(s) 468
Csp6I GTAC 1 cut(s) 231
CviAII CATG 2 cut(s) 92, 455
CviJI RGCY 3 cut(s) 297, 368, 479
CviKI_1 RGCY 3 cut(s) 297, 368, 479
CviQI GTAC 1 cut(s) 231
DdeI CTNAG 3 cut(s) 305, 439, 480
DpnI GATC 1 cut(s) 60
DpnII GATC 1 cut(s) 58
DrdI GACNNNNNNGTC 1 cut(s) 198
DseDI GACNNNNNNGTC 1 cut(s) 198
Eam1104I CTCTTC 1 cut(s) 115
EarI CTCTTC 1 cut(s) 115
Eco24I GRGCYC 1 cut(s) 481
Eco47I GGWCC 1 cut(s) 433
Eco57I CTGAAG 2 cut(s) 179, 354
Eco88I CYCGRG 1 cut(s) 209
EcoT38I GRGCYC 1 cut(s) 481
FaeI CATG 2 cut(s) 95, 458
FaiI YATR 8 cut(s) 51, 93, 176, 180, 289, 452, 456, 465
FatI CATG 2 cut(s) 91, 454
FokI GGATG 1 cut(s) 170
FriOI GRGCYC 1 cut(s) 481
FspBI CTAG 1 cut(s) 56
Hin1II CATG 2 cut(s) 95, 458
HinfI GANTC 4 cut(s) 75, 199, 212, 354
Hpy188I TCNGA 4 cut(s) 188, 198, 263, 442
Hpy188III TCNNGA 5 cut(s) 56, 122, 278, 311, 358
HpyAV CCTTC 1 cut(s) 149
HpyF3I CTNAG 3 cut(s) 305, 439, 480
Hsp92II CATG 2 cut(s) 95, 458
Kzo9I GATC 1 cut(s) 58
LmnI GCTCC 1 cut(s) 424
LpnPI CCDG 8 cut(s) 66, 107, 127, 311, 357, 359, 408, 445
LweI GCATC 1 cut(s) 304
MaeI CTAG 1 cut(s) 56
MalI GATC 1 cut(s) 60
MboI GATC 1 cut(s) 58
MboII GAAGA 2 cut(s) 102, 242
MflI RGATCY 1 cut(s) 58
MhlI GDGCHC 1 cut(s) 481
MluCI AATT 5 cut(s) 86, 96, 103, 125, 419
MlyI GAGTC 3 cut(s) 208, 221, 363
MmeI TCCRAC 1 cut(s) 90
MnlI CCTC 4 cut(s) 182, 346, 354, 446
MroXI GAANNNNTTC 1 cut(s) 268
Mva1269I GAATGC 1 cut(s) 331
NdeII GATC 1 cut(s) 58
NlaIII CATG 2 cut(s) 95, 458
PaeR7I CTCGAG 1 cut(s) 209
PctI GAATGC 1 cut(s) 331
PdmI GAANNNNTTC 1 cut(s) 268
PfeI GAWTC 1 cut(s) 75
PleI GAGTC 3 cut(s) 207, 220, 362
PpsI GAGTC 3 cut(s) 207, 220, 362
PspPI GGNCC 1 cut(s) 433
PspXI VCTCGAGB 1 cut(s) 209
PsuI RGATCY 1 cut(s) 58
RsaI GTAC 1 cut(s) 232
RsaNI GTAC 1 cut(s) 231
Sau3AI GATC 1 cut(s) 58
Sau96I GGNCC 1 cut(s) 433
SchI GAGTC 3 cut(s) 208, 221, 363
SduI GDGCHC 1 cut(s) 481
SetI ASST 5 cut(s) 285, 365, 438, 449, 464
SfaNI GCATC 1 cut(s) 304
SfcI CTRYAG 1 cut(s) 49
Sfr274I CTCGAG 1 cut(s) 209
SinI GGWCC 1 cut(s) 433
SlaI CTCGAG 1 cut(s) 209
SmlI CTYRAG 2 cut(s) 209, 358
SmoI CTYRAG 2 cut(s) 209, 358
Sse9I AATT 5 cut(s) 86, 96, 103, 125, 419
SspI AATATT 1 cut(s) 16
SspMI CTAG 1 cut(s) 56
TaqI TCGA 2 cut(s) 210, 468
TasI AATT 5 cut(s) 86, 96, 103, 125, 419
TfiI GAWTC 1 cut(s) 75
TspDTI ATGAA 3 cut(s) 108, 242, 276
VpaK11BI GGWCC 1 cut(s) 433
XapI RAATTY 2 cut(s) 96, 125
XbaI TCTAGA 1 cut(s) 55
XhoI CTCGAG 1 cut(s) 209
XmnI GAANNNNTTC 1 cut(s) 268
XspI CTAG 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.