Rmu_sc0000974.1_g000028

Arabidopsis protein of unknown function

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000974.1
Physical Location & Seq
Forward (+)
124287 .. 125138
852 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000974.1_g000028.1.cds

Sequence Viewer

Length: 852 bp
atggctcaaccagtgaggtctattagcttgccctctaggctaaaccccatttcccaaaagatcgagtcagagttaaacaagctaaggacttgtaaatcttcaagtccactagggagtgagtctcttttaatcagtttgtcaggtctagcagagctgttcaattccattgaggaactggttcaatctcaactgacccaacaagctcttagccaccagcaatgtaaatcactagtggaagaaacacttgacgggtcagtttggttgctagactcatgtggcaatgcaagagacttgctcttgacgatgaagcaacaggttcaagaccttcaatccgctttacgtaggaggaattcgagcattgatagcagtgttcacgcttacctttgctttagaaaaaaggcaaagaagaacgtcgcaaatagtctcagagaattgaagaagatggagagcaaatttgggtgttttttgcatatgttggatgtagactacaatgtactaattgtgatcaaattgttaagagaattaagtgctgtcacaatttctatgtttcagtcactatttgtgtttctatccatgccagtgactactagatggtcattggcatcaaaactgaaggctgtgacatttgggacggcctcggagaaagaccagaaggtttacaatgaagttggaactgttgatgttgctctcttctcactacacaagagtgatgccaagactgacgtgaagatggtgcagttgagattggaaacactggattgtagcataactgggcttgaggctggtttggaaagactgttcagatgcctattacaacatagagtgtctctactcaatctactaacaccataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

283

Amino Acids

31.69

Weight (kDa)

9.05

Isoelectric Point (pI)

53.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014886)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 483
AciI CCGC 1 cut(s) 333
AcsI RAATTY 2 cut(s) 349, 452
AcuI CTGAAG 1 cut(s) 632
AfaI GTAC 1 cut(s) 495
AgsI TTSAA 6 cut(s) 102, 160, 182, 320, 329, 436
AhlI ACTAGT 1 cut(s) 229
AjiI CACGTC 1 cut(s) 724
AleI CACNNNNGTG 1 cut(s) 705
AloI GAACNNNNNNTCC 2 cut(s) 782, 814
AluBI AGCT 4 cut(s) 27, 82, 154, 203
AluI AGCT 4 cut(s) 27, 82, 154, 203
Alw26I GTCTC 4 cut(s) 126, 282, 428, 831
AoxI GGCC 1 cut(s) 633
ApoI RAATTY 2 cut(s) 349, 452
Asp700I GAANNNNTTC 1 cut(s) 177
BccI CCATC 3 cut(s) 436, 585, 724
BceAI ACGGC 1 cut(s) 648
BclI TGATCA 1 cut(s) 504
BcoDI GTCTC 4 cut(s) 126, 282, 428, 831
BcuI ACTAGT 1 cut(s) 229
BfaI CTAG 6 cut(s) 36, 110, 146, 230, 266, 588
BglI GCCNNNNNGGC 1 cut(s) 37
BmgBI CACGTC 1 cut(s) 724
BmrI ACTGGG 1 cut(s) 780
BmsI GCATC 3 cut(s) 611, 700, 794
BmuI ACTGGG 1 cut(s) 780
BplI GAGNNNNNCTC 4 cut(s) 106, 138, 279, 311
Bpu10I CCTNAGC 1 cut(s) 83
BpuEI CTTGAG 1 cut(s) 797
BsaAI YACGTR 1 cut(s) 341
BsaJI CCNNGG 1 cut(s) 636
Bse1I ACTGG 5 cut(s) 11, 180, 578, 759, 775
Bse3DI GCAATG 2 cut(s) 224, 286
BseDI CCNNGG 1 cut(s) 636
BseGI GGATG 1 cut(s) 484
BseMI GCAATG 2 cut(s) 224, 286
BseMII CTCAG 1 cut(s) 439
BseNI ACTGG 5 cut(s) 11, 180, 578, 759, 775
BsgI GTGCAG 1 cut(s) 755
BshFI GGCC 1 cut(s) 635
BslFI GGGAC 1 cut(s) 643
BsmAI GTCTC 4 cut(s) 126, 282, 428, 831
BsmFI GGGAC 1 cut(s) 643
BsnI GGCC 1 cut(s) 635
Bsp143I GATC 2 cut(s) 60, 504
BspACI CCGC 1 cut(s) 333
BspANI GGCC 1 cut(s) 635
BspCNI CTCAG 1 cut(s) 438
BsrDI GCAATG 2 cut(s) 224, 286
BsrI ACTGG 5 cut(s) 11, 180, 578, 759, 775
BssECI CCNNGG 1 cut(s) 636
BssMI GATC 2 cut(s) 60, 504
Bst4CI ACNGT 2 cut(s) 676, 798
Bst6I CTCTTC 1 cut(s) 695
BstBAI YACGTR 1 cut(s) 341
BstC8I GCNNGC 1 cut(s) 29
BstDEI CTNAG 3 cut(s) 83, 206, 425
BstF5I GGATG 1 cut(s) 484
BstKTI GATC 2 cut(s) 63, 507
BstMAI GTCTC 4 cut(s) 126, 282, 428, 831
BstMBI GATC 2 cut(s) 60, 504
BstMWI GCNNNNNNNGC 2 cut(s) 37, 363
BstSNI TACGTA 1 cut(s) 341
BsuRI GGCC 1 cut(s) 635
BtrI CACGTC 1 cut(s) 724
BtsCI GGATG 1 cut(s) 484
BtsI GCAGTG 1 cut(s) 373
BtsIMutI CAGTG 4 cut(s) 18, 373, 585, 752
Cac8I GCNNGC 1 cut(s) 29
Csp6I GTAC 1 cut(s) 494
CviAII CATG 2 cut(s) 273, 574
CviQI GTAC 1 cut(s) 494
DdeI CTNAG 3 cut(s) 83, 206, 425
DpnI GATC 2 cut(s) 62, 506
DpnII GATC 2 cut(s) 60, 504
Eam1104I CTCTTC 1 cut(s) 695
EarI CTCTTC 1 cut(s) 695
Eco105I TACGTA 1 cut(s) 341
Eco57I CTGAAG 1 cut(s) 632
EcoRI GAATTC 1 cut(s) 349
FaeI CATG 2 cut(s) 276, 577
FaiI YATR 8 cut(s) 274, 471, 473, 545, 575, 767, 819, 850
FalI AAGNNNNNCTT 2 cut(s) 228, 260
FaqI GGGAC 1 cut(s) 643
FatI CATG 2 cut(s) 272, 573
FauNDI CATATG 1 cut(s) 471
FbaI TGATCA 1 cut(s) 504
FblI GTMKAC 1 cut(s) 483
FokI GGATG 1 cut(s) 491
FspBI CTAG 6 cut(s) 36, 110, 146, 230, 266, 588
HaeIII GGCC 1 cut(s) 635
Hin1II CATG 2 cut(s) 276, 577
HinfI GANTC 3 cut(s) 65, 119, 269
Hpy166II GTNNAC 4 cut(s) 107, 373, 484, 658
Hpy188I TCNGA 4 cut(s) 70, 428, 640, 803
Hpy188III TCNNGA 2 cut(s) 298, 320
Hpy8I GTNNAC 4 cut(s) 107, 373, 484, 658
Hpy99I CGWCG 1 cut(s) 416
HpyAV CCTTC 3 cut(s) 335, 607, 646
HpyCH4III ACNGT 2 cut(s) 676, 798
HpyCH4IV ACGT 3 cut(s) 340, 411, 723
HpyCH4V TGCA 3 cut(s) 284, 469, 736
HpyF10VI GCNNNNNNNGC 2 cut(s) 37, 363
HpyF3I CTNAG 3 cut(s) 83, 206, 425
HpySE526I ACGT 3 cut(s) 340, 411, 723
Hsp92II CATG 2 cut(s) 276, 577
Ksp22I TGATCA 1 cut(s) 504
Kzo9I GATC 2 cut(s) 60, 504
LweI GCATC 3 cut(s) 611, 700, 794
MaeI CTAG 6 cut(s) 36, 110, 146, 230, 266, 588
MaeII ACGT 3 cut(s) 340, 411, 723
MaeIII GTNAC 4 cut(s) 532, 552, 580, 619
MalI GATC 2 cut(s) 62, 506
MboI GATC 2 cut(s) 60, 504
MboII GAAGA 7 cut(s) 90, 248, 418, 448, 451, 682, 739
MluCI AATT 8 cut(s) 160, 349, 431, 452, 498, 509, 521, 537
MlyI GAGTC 3 cut(s) 74, 128, 263
MmeI TCCRAC 2 cut(s) 456, 649
MnlI CCTC 6 cut(s) 9, 43, 163, 339, 646, 772
MroXI GAANNNNTTC 1 cut(s) 177
MseI TTAA 4 cut(s) 74, 128, 515, 524
MslI CAYNNNNRTG 2 cut(s) 578, 705
MwoI GCNNNNNNNGC 2 cut(s) 37, 363
NdeI CATATG 1 cut(s) 471
NdeII GATC 2 cut(s) 60, 504
NlaIII CATG 2 cut(s) 276, 577
NmuCI GTSAC 4 cut(s) 532, 552, 580, 619
OliI CACNNNNGTG 1 cut(s) 705
PdmI GAANNNNTTC 1 cut(s) 177
PleI GAGTC 3 cut(s) 73, 127, 263
PpsI GAGTC 3 cut(s) 73, 127, 263
Ppu21I YACGTR 1 cut(s) 341
RsaI GTAC 1 cut(s) 495
RsaNI GTAC 1 cut(s) 494
RseI CAYNNNNRTG 2 cut(s) 578, 705
SaqAI TTAA 4 cut(s) 74, 128, 515, 524
Sau3AI GATC 2 cut(s) 60, 504
SchI GAGTC 3 cut(s) 74, 128, 263
SfaNI GCATC 3 cut(s) 611, 700, 794
SmiMI CAYNNNNRTG 2 cut(s) 578, 705
SmlI CTYRAG 1 cut(s) 776
SmoI CTYRAG 1 cut(s) 776
SnaBI TACGTA 1 cut(s) 341
SpeI ACTAGT 1 cut(s) 229
Sse9I AATT 8 cut(s) 160, 349, 431, 452, 498, 509, 521, 537
SsiI CCGC 1 cut(s) 333
SspMI CTAG 6 cut(s) 36, 110, 146, 230, 266, 588
TaaI ACNGT 2 cut(s) 676, 798
TaiI ACGT 3 cut(s) 343, 414, 726
TaqI TCGA 2 cut(s) 63, 353
TasI AATT 8 cut(s) 160, 349, 431, 452, 498, 509, 521, 537
TatI WGTACW 1 cut(s) 493
Tru1I TTAA 4 cut(s) 74, 128, 515, 524
Tru9I TTAA 4 cut(s) 74, 128, 515, 524
TscAI CASTG 4 cut(s) 18, 373, 585, 759
TseFI GTSAC 4 cut(s) 532, 552, 580, 619
Tsp45I GTSAC 4 cut(s) 532, 552, 580, 619
TspDTI ATGAA 2 cut(s) 320, 678
TspRI CASTG 4 cut(s) 18, 373, 585, 759
XapI RAATTY 2 cut(s) 349, 452
XcmI CCANNNNNNNNNTGG 1 cut(s) 172
XmiI GTMKAC 1 cut(s) 483
XmnI GAANNNNTTC 1 cut(s) 177
XspI CTAG 6 cut(s) 36, 110, 146, 230, 266, 588
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.