Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001168.1

Orthogroup ID

OG0017971

Physical Location & Seq

Genomic Coordinates Reverse (-)

10408 .. 11232

Gene Structure 825 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001168.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 825 bp

atggatcttgatgaagaaggtcgactaaggaacctcttttgggctgatgctaggagtagagcaacttgtgaagatttcggagatgttatcacatttgacacaacatgcttgaccaataaatatgatatgccatttgctccttttgttggagtaaatcatcataatcagtctttattattgagttgtggcttgctttgtgatgagactacaatgtcatttacatggctatttgaggtgtggaagacatgcatgaagggaaaatctccaaatgctataattactgatcaatgtgcagaaatgaaaaatgctattgaggttgtgtttccaaatgctaaacatcgatggtgcttgtggcatattatggaaaagattccaaaaaagctcaggggttacaaaaaagaatatgaggagataaagactattatgactgatgcagtatatgaagcattaactattgatgactttgagagagaatggacatccatgcgtgagaaatattttcccaatggagataattggttagatgggttgtataaagaaaggcatcgatgggttcctatatatttgaaagatacattttgggctggaatgtcaactacgcaatggagtgaaagcattaattcatacttcgacaaatatgtgaagtcgaaaaccagtttgaaaatctttgtagaacaatatggagcagccatggcagataagattgaaaaggaagagcaagaagaatttaatacgttgtatagaggtgtagaaccatttagtggtttcaagtttgagaaacaatttcgagatgcttatacaaatgcaaaattcaaagagttttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FAR1 MULE SWIM

Protein Analysis

274

Amino Acids

32.5

Weight (kDa)

5.44

Isoelectric Point (pI)

42.23

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017971)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g26761
rosa_multiflora	Rmu_sc0001168.1_g000004 Rmu_sc0001836.1_g000051 Rmu_sc0002798.1_g000008
rosa_samantha	Rh1AG047900 Rh1CG052200 Rh1DG056400 Rh2AG333300 Rh4DG412300 Rh5AG276700 Rh6AG081600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	211
AccB7I	CCANNNNNTGG	1 cut(s)	761
AccI	GTMKAC	1 cut(s)	22
AclWI	GGATC	1 cut(s)	12
AcsI	RAATTY	2 cut(s)	725, 809
AfiI	CCNNNNNNNGG	3 cut(s)	40, 146, 761
AgsI	TTSAA	5 cut(s)	568, 661, 707, 769, 814
AluBI	AGCT	1 cut(s)	382
AluI	AGCT	1 cut(s)	382
Alw26I	GTCTC	1 cut(s)	197
AlwI	GGATC	1 cut(s)	12
ApeKI	GCWGC	1 cut(s)	686
ApoI	RAATTY	2 cut(s)	725, 809
AseI	ATTAAT	1 cut(s)	618
Asp700I	GAANNNNTTC	1 cut(s)	369
BbsI	GAAGAC	1 cut(s)	248
BbvI	GCAGC	1 cut(s)	698
BccI	CCATC	3 cut(s)	336, 518, 543
BclI	TGATCA	1 cut(s)	283
BcoDI	GTCTC	1 cut(s)	197
BfaI	CTAG	1 cut(s)	51
BisI	GCNGC	1 cut(s)	687
BlsI	GCNGC	1 cut(s)	688
BmiI	GGNNCC	2 cut(s)	32, 555
BmsI	GCATC	4 cut(s)	37, 421, 553, 781
BpiI	GAAGAC	1 cut(s)	248
Bpu10I	CCTNAGC	1 cut(s)	383
Bsa29I	ATCGAT	2 cut(s)	340, 547
BsaJI	CCNNGG	1 cut(s)	690
Bsc4I	CCNNNNNNNGG	3 cut(s)	40, 146, 761
Bse1I	ACTGG	1 cut(s)	654
Bse3DI	GCAATG	1 cut(s)	608
BseCI	ATCGAT	2 cut(s)	340, 547
BseDI	CCNNGG	1 cut(s)	690
BseGI	GGATG	1 cut(s)	479
BseLI	CCNNNNNNNGG	3 cut(s)	40, 146, 761
BseMI	GCAATG	1 cut(s)	608
BseMII	CTCAG	1 cut(s)	397
BseNI	ACTGG	1 cut(s)	654
BseRI	GAGGAG	1 cut(s)	422
BseXI	GCAGC	1 cut(s)	698
BsgI	GTGCAG	1 cut(s)	312
BshVI	ATCGAT	2 cut(s)	340, 547
BslI	CCNNNNNNNGG	3 cut(s)	40, 146, 761
BsmAI	GTCTC	1 cut(s)	197
Bsp143I	GATC	2 cut(s)	4, 283
Bsp19I	CCATGG	1 cut(s)	690
BspCNI	CTCAG	1 cut(s)	396
BspDI	ATCGAT	2 cut(s)	340, 547
BspLI	GGNNCC	2 cut(s)	32, 555
BspPI	GGATC	1 cut(s)	12
BspQI	GCTCTTC	1 cut(s)	708
BsrDI	GCAATG	1 cut(s)	608
BsrI	ACTGG	1 cut(s)	654
BssECI	CCNNGG	1 cut(s)	690
BssMI	GATC	2 cut(s)	4, 283
BssT1I	CCWWGG	1 cut(s)	690
Bst6I	CTCTTC	1 cut(s)	708
BstC8I	GCNNGC	1 cut(s)	191
BstDEI	CTNAG	2 cut(s)	26, 383
BstDSI	CCRYGG	1 cut(s)	690
BstF5I	GGATG	1 cut(s)	479
BstKTI	GATC	2 cut(s)	7, 286
BstMAI	GTCTC	1 cut(s)	197
BstMBI	GATC	2 cut(s)	4, 283
BstMWI	GCNNNNNNNGC	1 cut(s)	692
BstNSI	RCATGY	2 cut(s)	108, 249
BstV1I	GCAGC	1 cut(s)	698
BstV2I	GAAGAC	1 cut(s)	248
BstX2I	RGATCY	1 cut(s)	4
BstYI	RGATCY	1 cut(s)	4
Bsu15I	ATCGAT	2 cut(s)	340, 547
BsuTUI	ATCGAT	2 cut(s)	340, 547
BtgI	CCRYGG	1 cut(s)	690
BtsCI	GGATG	1 cut(s)	479
Cac8I	GCNNGC	1 cut(s)	191
ClaI	ATCGAT	2 cut(s)	340, 547
CviAII	CATG	6 cut(s)	105, 222, 246, 250, 484, 691
CviJI	RGCY	6 cut(s)	44, 189, 226, 382, 584, 689
CviKI_1	RGCY	6 cut(s)	44, 189, 226, 382, 584, 689
DdeI	CTNAG	2 cut(s)	26, 383
DpnI	GATC	2 cut(s)	6, 285
DpnII	GATC	2 cut(s)	4, 283
DrdI	GACNNNNNNGTC	1 cut(s)	211
DseDI	GACNNNNNNGTC	1 cut(s)	211
Eam1104I	CTCTTC	1 cut(s)	708
EarI	CTCTTC	1 cut(s)	708
Eco130I	CCWWGG	1 cut(s)	690
EcoT14I	CCWWGG	1 cut(s)	690
EcoT22I	ATGCAT	1 cut(s)	251
ErhI	CCWWGG	1 cut(s)	690
FaeI	CATG	6 cut(s)	108, 225, 249, 253, 487, 694
FatI	CATG	6 cut(s)	104, 221, 245, 249, 483, 690
FbaI	TGATCA	1 cut(s)	283
FblI	GTMKAC	1 cut(s)	22
Fnu4HI	GCNGC	1 cut(s)	687
FokI	GGATG	1 cut(s)	466
Fsp4HI	GCNGC	1 cut(s)	687
FspBI	CTAG	1 cut(s)	51
GluI	GCNGC	1 cut(s)	687
Hin1II	CATG	6 cut(s)	108, 225, 249, 253, 487, 694
HincII	GTYRAC	2 cut(s)	23, 594
HindII	GTYRAC	2 cut(s)	23, 594
HinfI	GANTC	1 cut(s)	370
Hpy166II	GTNNAC	2 cut(s)	23, 594
Hpy188I	TCNGA	1 cut(s)	80
Hpy188III	TCNNGA	2 cut(s)	8, 788
Hpy8I	GTNNAC	2 cut(s)	23, 594
HpyAV	CCTTC	2 cut(s)	11, 247
HpyCH4IV	ACGT	1 cut(s)	734
HpyCH4V	TGCA	4 cut(s)	249, 293, 434, 806
HpyF10VI	GCNNNNNNNGC	1 cut(s)	692
HpyF3I	CTNAG	2 cut(s)	26, 383
HpySE526I	ACGT	1 cut(s)	734
Hsp92II	CATG	6 cut(s)	108, 225, 249, 253, 487, 694
Ksp22I	TGATCA	1 cut(s)	283
Kzo9I	GATC	2 cut(s)	4, 283
LguI	GCTCTTC	1 cut(s)	708
LmnI	GCTCC	2 cut(s)	142, 683
LpnPI	CCDG	3 cut(s)	370, 570, 667
Lsp1109I	GCAGC	1 cut(s)	698
LweI	GCATC	4 cut(s)	37, 421, 553, 781
MaeI	CTAG	1 cut(s)	51
MaeII	ACGT	1 cut(s)	734
MaeIII	GTNAC	1 cut(s)	389
MalI	GATC	2 cut(s)	6, 285
MboI	GATC	2 cut(s)	4, 283
MboII	GAAGA	5 cut(s)	26, 83, 253, 725, 734
MflI	RGATCY	1 cut(s)	4
MluCI	AATT	6 cut(s)	276, 514, 619, 725, 782, 809
MmeI	TCCRAC	1 cut(s)	127
MnlI	CCTC	5 cut(s)	44, 226, 307, 400, 737
Mph1103I	ATGCAT	1 cut(s)	251
MroXI	GAANNNNTTC	1 cut(s)	369
MseI	TTAA	3 cut(s)	449, 618, 729
MslI	CAYNNNNRTG	1 cut(s)	220
MwoI	GCNNNNNNNGC	1 cut(s)	692
NcoI	CCATGG	1 cut(s)	690
NdeII	GATC	2 cut(s)	4, 283
NlaIII	CATG	6 cut(s)	108, 225, 249, 253, 487, 694
NlaIV	GGNNCC	2 cut(s)	32, 555
NsiI	ATGCAT	1 cut(s)	251
NspI	RCATGY	2 cut(s)	108, 249
PciSI	GCTCTTC	1 cut(s)	708
PdmI	GAANNNNTTC	1 cut(s)	369
PfeI	GAWTC	1 cut(s)	370
PflMI	CCANNNNNTGG	1 cut(s)	761
PkrI	GCNGC	1 cut(s)	688
PshBI	ATTAAT	1 cut(s)	618
PspN4I	GGNNCC	2 cut(s)	32, 555
PsuI	RGATCY	1 cut(s)	4
RseI	CAYNNNNRTG	1 cut(s)	220
SalI	GTCGAC	1 cut(s)	21
SapI	GCTCTTC	1 cut(s)	708
SaqAI	TTAA	3 cut(s)	449, 618, 729
SatI	GCNGC	1 cut(s)	687
Sau3AI	GATC	2 cut(s)	4, 283
SetI	ASST	7 cut(s)	22, 36, 237, 318, 384, 737, 748
SfaNI	GCATC	4 cut(s)	37, 421, 553, 781
SmiMI	CAYNNNNRTG	1 cut(s)	220
Sse9I	AATT	6 cut(s)	276, 514, 619, 725, 782, 809
SspI	AATATT	1 cut(s)	497
SspMI	CTAG	1 cut(s)	51
StyI	CCWWGG	1 cut(s)	690
TaiI	ACGT	1 cut(s)	737
TaqI	TCGA	6 cut(s)	22, 340, 547, 630, 647, 787
TasI	AATT	6 cut(s)	276, 514, 619, 725, 782, 809
TfiI	GAWTC	1 cut(s)	370
Tru1I	TTAA	3 cut(s)	449, 618, 729
Tru9I	TTAA	3 cut(s)	449, 618, 729
TseI	GCWGC	1 cut(s)	686
TspDTI	ATGAA	5 cut(s)	27, 266, 314, 456, 612
Van91I	CCANNNNNTGG	1 cut(s)	761
VspI	ATTAAT	1 cut(s)	618
XapI	RAATTY	2 cut(s)	725, 809
XceI	RCATGY	2 cut(s)	108, 249
XmiI	GTMKAC	1 cut(s)	22
XmnI	GAANNNNTTC	1 cut(s)	369
XspI	CTAG	1 cut(s)	51
Zsp2I	ATGCAT	1 cut(s)	251

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.