Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002798.1

Orthogroup ID

OG0017971

Physical Location & Seq

Genomic Coordinates Reverse (-)

58681 .. 60768

Gene Structure 2088 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002798.1_g000008.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1224 bp

atggatggaaatgatacctcacaagtaccctgctacgtcaaggaagatgatgacgtgattatatcaaacgaagttgaatcagatgatggagatattccagaaagaggaatgagatttaattcttatgatggtttgtatgattattgtgaagattatgctaagaagtcaggttgggcaattagaaaaagatccaaccccaaaaaagagggagcaattaagtacgtccagcttgtatgttcaagagcattgagaggtaaatcccctaaagaaagtgagccgatatcttcacagataactgggtgttttgcgcgtatccgagcagtgcttaagtcagatggggagtacaatttgaccacagtatgtctagaccataatcatccattgtgtccaacaacagccagacgtataaggcaatatagagagctagatcaacattcaaaagataggttttgttttaatgaagatgctggtgttcgacaatccaaaagttatcatgctatactgactgaaaaaggtggatacgcaaatttgggatatagcgaaagagatgcacgaaacttcattgacaagagaagaagattgaaacttcagagtggtgatgcagatgccctgcatagatatttcattatgatgcaaaaaaataatcccaactttttttattccatggatcttgatgaagaaggacgactaaggaacctcttttgggctgatgctaggagtagagcagcttgtgaagatttcggagatgttatcacgtttgacacgacatgcttgaccaataaatatgatatgccatttgctccttttgttggagtaaatcatcatggtcagtctttattattgggttgtggcttgctttgtgatgagactacaatgtcatttacatggctatttgaggtgtggaagacatgcatgaagggaaaatctccaaatgctataattactgatcaatgtgcagcaatgaaaaatgctattgaggttgtgtttccagatgctaaacatcgattgtgtttgtggcatattatggaaaagattccaaaaaagctcaggggttacaaaaaagaatacgaggagataaagactattatgactgatgcagtatatgaaacgttgattatactagaggagctatctaaagatttcggaggggtaatcttcgatcataagatgtactccactgacataattcctcttgcgaaggtcgtaaagcaaacaaatacgtaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

FAR1 MULE SWIM

Protein Analysis

407

Amino Acids

46.75

Weight (kDa)

6.57

Isoelectric Point (pI)

47.51

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017971)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_1g26761
rosa_multiflora	Rmu_sc0001168.1_g000004 Rmu_sc0001836.1_g000051 Rmu_sc0002798.1_g000008
rosa_samantha	Rh1AG047900 Rh1CG052200 Rh1DG056400 Rh2AG333300 Rh4DG412300 Rh5AG276700 Rh6AG081600

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	874
AccII	CGCG	1 cut(s)	310
AclI	AACGTT	1 cut(s)	1109
AclWI	GGATC	2 cut(s)	183, 675
AcsI	RAATTY	1 cut(s)	526
AcuI	CTGAAG	1 cut(s)	572
AfaI	GTAC	4 cut(s)	27, 221, 344, 1172
AfiI	CCNNNNNNNGG	3 cut(s)	104, 703, 809
AflII	CTTAAG	1 cut(s)	326
AgsI	TTSAA	4 cut(s)	77, 240, 438, 583
AjiI	CACGTC	1 cut(s)	55
AluBI	AGCT	5 cut(s)	229, 424, 728, 1045, 1129
AluI	AGCT	5 cut(s)	229, 424, 728, 1045, 1129
Alw26I	GTCTC	1 cut(s)	860
AlwI	GGATC	2 cut(s)	183, 675
ApeKI	GCWGC	2 cut(s)	725, 956
ApoI	RAATTY	1 cut(s)	526
Asp700I	GAANNNNTTC	1 cut(s)	1032
AspLEI	GCGC	1 cut(s)	310
AsuHPI	GGTGA	1 cut(s)	608
BbsI	GAAGAC	1 cut(s)	911
BbvI	GCAGC	2 cut(s)	737, 968
BccI	CCATC	3 cut(s)	80, 122, 329
BcgI	CGANNNNNNTGC	2 cut(s)	530, 564
BciVI	GTATCC	2 cut(s)	323, 512
BclI	TGATCA	1 cut(s)	946
BcoDI	GTCTC	1 cut(s)	860
BfaI	CTAG	4 cut(s)	365, 425, 714, 1121
BfrI	CTTAAG	1 cut(s)	326
BfuI	GTATCC	2 cut(s)	323, 512
BisI	GCNGC	2 cut(s)	726, 957
BlsI	GCNGC	2 cut(s)	727, 958
BmgBI	CACGTC	1 cut(s)	55
BmiI	GGNNCC	1 cut(s)	695
BmrI	ACTGGG	1 cut(s)	306
BmsI	GCATC	8 cut(s)	454, 538, 589, 595, 621, 700, 982, 1084
BmuI	ACTGGG	1 cut(s)	306
BpiI	GAAGAC	1 cut(s)	911
Bpu10I	CCTNAGC	1 cut(s)	1046
Bsa29I	ATCGAT	1 cut(s)	1003
BsaAI	YACGTR	1 cut(s)	1221
BsaJI	CCNNGG	1 cut(s)	663
Bsc4I	CCNNNNNNNGG	3 cut(s)	104, 703, 809
Bse1I	ACTGG	1 cut(s)	301
Bse3DI	GCAATG	1 cut(s)	966
BseCI	ATCGAT	1 cut(s)	1003
BseDI	CCNNGG	1 cut(s)	663
BseGI	GGATG	2 cut(s)	10, 376
BseLI	CCNNNNNNNGG	3 cut(s)	104, 703, 809
BseMI	GCAATG	1 cut(s)	966
BseMII	CTCAG	1 cut(s)	1060
BseNI	ACTGG	1 cut(s)	301
BseRI	GAGGAG	2 cut(s)	1085, 1139
BseXI	GCAGC	2 cut(s)	737, 968
BsgI	GTGCAG	1 cut(s)	975
Bsh1236I	CGCG	1 cut(s)	310
BshVI	ATCGAT	1 cut(s)	1003
BslI	CCNNNNNNNGG	3 cut(s)	104, 703, 809
BsmAI	GTCTC	1 cut(s)	860
Bsp143I	GATC	5 cut(s)	188, 427, 667, 946, 1159
Bsp19I	CCATGG	1 cut(s)	663
BspCNI	CTCAG	1 cut(s)	1059
BspDI	ATCGAT	1 cut(s)	1003
BspFNI	CGCG	1 cut(s)	310
BspLI	GGNNCC	1 cut(s)	695
BspPI	GGATC	2 cut(s)	183, 675
BspTI	CTTAAG	1 cut(s)	326
BsrDI	GCAATG	1 cut(s)	966
BsrI	ACTGG	1 cut(s)	301
BssECI	CCNNGG	1 cut(s)	663
BssMI	GATC	5 cut(s)	188, 427, 667, 946, 1159
BssT1I	CCWWGG	1 cut(s)	663
Bst4CI	ACNGT	1 cut(s)	358
BstAFI	CTTAAG	1 cut(s)	326
BstBAI	YACGTR	1 cut(s)	1221
BstC8I	GCNNGC	1 cut(s)	854
BstDEI	CTNAG	3 cut(s)	159, 689, 1046
BstDSI	CCRYGG	1 cut(s)	663
BstF5I	GGATG	2 cut(s)	10, 376
BstFNI	CGCG	1 cut(s)	310
BstHHI	GCGC	1 cut(s)	310
BstKTI	GATC	5 cut(s)	191, 430, 670, 949, 1162
BstMAI	GTCTC	1 cut(s)	860
BstMBI	GATC	5 cut(s)	188, 427, 667, 946, 1159
BstNSI	RCATGY	2 cut(s)	771, 912
BstSNI	TACGTA	1 cut(s)	1221
BstUI	CGCG	1 cut(s)	310
BstV1I	GCAGC	2 cut(s)	737, 968
BstV2I	GAAGAC	1 cut(s)	911
BstX2I	RGATCY	2 cut(s)	188, 667
BstYI	RGATCY	2 cut(s)	188, 667
Bsu15I	ATCGAT	1 cut(s)	1003
BsuI	GTATCC	2 cut(s)	323, 512
BsuTUI	ATCGAT	1 cut(s)	1003
BtgI	CCRYGG	1 cut(s)	663
BtrI	CACGTC	1 cut(s)	55
BtsCI	GGATG	2 cut(s)	10, 376
BtsI	GCAGTG	1 cut(s)	327
BtsIMutI	CAGTG	2 cut(s)	327, 1176
Cac8I	GCNNGC	1 cut(s)	854
CfoI	GCGC	1 cut(s)	310
ClaI	ATCGAT	1 cut(s)	1003
Csp6I	GTAC	4 cut(s)	26, 220, 343, 1171
CviAII	CATG	7 cut(s)	494, 664, 768, 824, 885, 909, 913
CviQI	GTAC	4 cut(s)	26, 220, 343, 1171
DdeI	CTNAG	3 cut(s)	159, 689, 1046
DpnI	GATC	5 cut(s)	190, 429, 669, 948, 1161
DpnII	GATC	5 cut(s)	188, 427, 667, 946, 1159
DrdI	GACNNNNNNGTC	1 cut(s)	874
DseDI	GACNNNNNNGTC	1 cut(s)	874
Eco105I	TACGTA	1 cut(s)	1221
Eco130I	CCWWGG	1 cut(s)	663
Eco32I	GATATC	1 cut(s)	282
Eco57I	CTGAAG	1 cut(s)	572
EcoRV	GATATC	1 cut(s)	282
EcoT14I	CCWWGG	1 cut(s)	663
EcoT22I	ATGCAT	1 cut(s)	914
ErhI	CCWWGG	1 cut(s)	663
FaeI	CATG	7 cut(s)	497, 667, 771, 827, 888, 912, 916
FatI	CATG	7 cut(s)	493, 663, 767, 823, 884, 908, 912
FbaI	TGATCA	1 cut(s)	946
Fnu4HI	GCNGC	2 cut(s)	726, 957
FokI	GGATG	2 cut(s)	17, 363
Fsp4HI	GCNGC	2 cut(s)	726, 957
FspBI	CTAG	4 cut(s)	365, 425, 714, 1121
GlaI	GCGC	1 cut(s)	309
GluI	GCNGC	2 cut(s)	726, 957
HhaI	GCGC	1 cut(s)	310
Hin1II	CATG	7 cut(s)	497, 667, 771, 827, 888, 912, 916
Hin6I	GCGC	1 cut(s)	308
HinP1I	GCGC	1 cut(s)	308
HinfI	GANTC	2 cut(s)	77, 1033
HphI	GGTGA	1 cut(s)	608
Hpy188I	TCNGA	6 cut(s)	82, 317, 334, 591, 743, 1145
Hpy188III	TCNNGA	5 cut(s)	98, 240, 365, 671, 989
HpyAV	CCTTC	3 cut(s)	674, 910, 1192
HpyCH4III	ACNGT	1 cut(s)	358
HpyCH4IV	ACGT	7 cut(s)	36, 54, 222, 403, 755, 1109, 1220
HpyCH4V	TGCA	7 cut(s)	551, 602, 613, 634, 912, 956, 1097
HpyF3I	CTNAG	3 cut(s)	159, 689, 1046
HpySE526I	ACGT	7 cut(s)	36, 54, 222, 403, 755, 1109, 1220
Hsp92II	CATG	7 cut(s)	497, 667, 771, 827, 888, 912, 916
HspAI	GCGC	1 cut(s)	308
Ksp22I	TGATCA	1 cut(s)	946
Kzo9I	GATC	5 cut(s)	188, 427, 667, 946, 1159
LmnI	GCTCC	3 cut(s)	209, 805, 1126
Lsp1109I	GCAGC	2 cut(s)	737, 968
LweI	GCATC	8 cut(s)	454, 538, 589, 595, 621, 700, 982, 1084
MaeI	CTAG	4 cut(s)	365, 425, 714, 1121
MaeII	ACGT	7 cut(s)	36, 54, 222, 403, 755, 1109, 1220
MaeIII	GTNAC	1 cut(s)	1052
MalI	GATC	5 cut(s)	190, 429, 669, 948, 1161
MboI	GATC	5 cut(s)	188, 427, 667, 946, 1159
MflI	RGATCY	2 cut(s)	188, 667
MluCI	AATT	7 cut(s)	118, 177, 213, 346, 526, 939, 1185
MmeI	TCCRAC	3 cut(s)	216, 413, 790
Mph1103I	ATGCAT	1 cut(s)	914
MroXI	GAANNNNTTC	1 cut(s)	1032
MseI	TTAA	4 cut(s)	117, 216, 327, 456
MslI	CAYNNNNRTG	2 cut(s)	629, 883
MspCI	CTTAAG	1 cut(s)	326
MvnI	CGCG	1 cut(s)	310
NcoI	CCATGG	1 cut(s)	663
NdeII	GATC	5 cut(s)	188, 427, 667, 946, 1159
NlaIII	CATG	7 cut(s)	497, 667, 771, 827, 888, 912, 916
NlaIV	GGNNCC	1 cut(s)	695
NsiI	ATGCAT	1 cut(s)	914
NspI	RCATGY	2 cut(s)	771, 912
PcsI	WCGNNNNNNNCGW	1 cut(s)	761
PdmI	GAANNNNTTC	1 cut(s)	1032
PfeI	GAWTC	2 cut(s)	77, 1033
PkrI	GCNGC	2 cut(s)	727, 958
Ppu21I	YACGTR	1 cut(s)	1221
Psp1406I	AACGTT	1 cut(s)	1109
PspN4I	GGNNCC	1 cut(s)	695
PsuI	RGATCY	2 cut(s)	188, 667
RsaI	GTAC	4 cut(s)	27, 221, 344, 1172
RsaNI	GTAC	4 cut(s)	26, 220, 343, 1171
RseI	CAYNNNNRTG	2 cut(s)	629, 883
SaqAI	TTAA	4 cut(s)	117, 216, 327, 456
SatI	GCNGC	2 cut(s)	726, 957
Sau3AI	GATC	5 cut(s)	188, 427, 667, 946, 1159
SfaNI	GCATC	8 cut(s)	454, 538, 589, 595, 621, 700, 982, 1084
SmiMI	CAYNNNNRTG	2 cut(s)	629, 883
SmlI	CTYRAG	1 cut(s)	326
SmoI	CTYRAG	1 cut(s)	326
SnaBI	TACGTA	1 cut(s)	1221
Sse9I	AATT	7 cut(s)	118, 177, 213, 346, 526, 939, 1185
SspMI	CTAG	4 cut(s)	365, 425, 714, 1121
StyI	CCWWGG	1 cut(s)	663
TaaI	ACNGT	1 cut(s)	358
TaiI	ACGT	7 cut(s)	39, 57, 225, 406, 758, 1112, 1223
TaqI	TCGA	3 cut(s)	475, 1003, 1158
TasI	AATT	7 cut(s)	118, 177, 213, 346, 526, 939, 1185
TatI	WGTACW	2 cut(s)	342, 1170
TfiI	GAWTC	2 cut(s)	77, 1033
Tru1I	TTAA	4 cut(s)	117, 216, 327, 456
Tru9I	TTAA	4 cut(s)	117, 216, 327, 456
TscAI	CASTG	2 cut(s)	327, 1183
TseI	GCWGC	2 cut(s)	725, 956
TspDTI	ATGAA	7 cut(s)	474, 550, 613, 690, 929, 977, 1119
TspRI	CASTG	2 cut(s)	327, 1183
Vha464I	CTTAAG	1 cut(s)	326
XapI	RAATTY	1 cut(s)	526
XbaI	TCTAGA	1 cut(s)	364
XceI	RCATGY	2 cut(s)	771, 912
XmnI	GAANNNNTTC	1 cut(s)	1032
XspI	CTAG	4 cut(s)	365, 425, 714, 1121
Zsp2I	ATGCAT	1 cut(s)	914

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.