Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001195.1

Orthogroup ID

OG0017594

Physical Location & Seq

Genomic Coordinates Forward (+)

46575 .. 47069

Gene Structure 495 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001195.1_g000009.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 495 bp

atggcagtgaggatgaagaataagtttcaaaaatattttggcaacatcgatgatgtcaatcaacttcttttggttgccttagttcttgatcctaggtataagctacgaaatttcactcatatttgcaagactgagttgggcatggatgatggtgaagctaaagagagggaagcaaaggtcaaagatctgctagtagccttgattgatacatatgcagcttcaatgaattcagcctcaaaccaaaaggagaaggtcaccattggatcgaggcattctggtatgagaaatgctagtggcaagatggccgaaatgatggataattgggcgaaagaacttgagaacagcgttgaaattgtggtggagtgtgaagttgatcaatacattattgatcccttcgagaggcctaaagtgggggaaacctttgaaattttaaattggtggaagcacagtggatcgaatatctcaacttgcaagatgtggcaaaagatgttctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DUF4413

Protein Analysis

164

Amino Acids

18.9

Weight (kDa)

6.32

Isoelectric Point (pI)

30.22

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017594)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g05171
rosa_laevigata	RLG00000013247
rosa_multiflora	Rmu_sc0001195.1_g000009 Rmu_sc0001287.1_g000031 Rmu_sc0005322.1_g000016 Rmu_sc0009709.1_g000012
rosa_roxburghii	Rroxscaffold_2G00142030
rosa_samantha	Rh1DG111400 Rh3DG200100 Rh3DG319500 Rh5AG434100 Rh6BG367900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	4 cut(s)	83, 271, 383, 460
AcoI	YGGCCR	1 cut(s)	303
AcsI	RAATTY	3 cut(s)	109, 226, 426
AfiI	CCNNNNNNNGG	2 cut(s)	399, 410
AgsI	TTSAA	4 cut(s)	29, 222, 350, 425
AluBI	AGCT	3 cut(s)	103, 158, 218
AluI	AGCT	3 cut(s)	103, 158, 218
AlwI	GGATC	4 cut(s)	83, 271, 383, 460
AoxI	GGCC	2 cut(s)	303, 401
ApeKI	GCWGC	1 cut(s)	215
ApoI	RAATTY	3 cut(s)	109, 226, 426
AspA2I	CCTAGG	1 cut(s)	92
AsuHPI	GGTGA	2 cut(s)	164, 247
AvrII	CCTAGG	1 cut(s)	92
BbvI	GCAGC	1 cut(s)	227
BccI	CCATC	3 cut(s)	143, 295, 307
BclI	TGATCA	1 cut(s)	373
BfaI	CTAG	4 cut(s)	93, 191, 291, 493
BglII	AGATCT	1 cut(s)	184
BisI	GCNGC	1 cut(s)	216
BlnI	CCTAGG	1 cut(s)	92
BlsI	GCNGC	1 cut(s)	217
BpuEI	CTTGAG	1 cut(s)	356
Bsa29I	ATCGAT	1 cut(s)	48
BsaBI	GATNNNNATC	1 cut(s)	57
BsaJI	CCNNGG	1 cut(s)	92
Bsc4I	CCNNNNNNNGG	2 cut(s)	399, 410
Bse8I	GATNNNNATC	1 cut(s)	57
BseCI	ATCGAT	1 cut(s)	48
BseDI	CCNNGG	1 cut(s)	92
BseGI	GGATG	2 cut(s)	18, 151
BseJI	GATNNNNATC	1 cut(s)	57
BseLI	CCNNNNNNNGG	2 cut(s)	399, 410
BseMII	CTCAG	1 cut(s)	123
BseXI	GCAGC	1 cut(s)	227
BshFI	GGCC	2 cut(s)	305, 403
BshVI	ATCGAT	1 cut(s)	48
BslI	CCNNNNNNNGG	2 cut(s)	399, 410
BsmI	GAATGC	1 cut(s)	271
BsnI	GGCC	2 cut(s)	305, 403
Bsp143I	GATC	6 cut(s)	88, 184, 263, 373, 388, 452
BspANI	GGCC	2 cut(s)	305, 403
BspCNI	CTCAG	1 cut(s)	124
BspDI	ATCGAT	1 cut(s)	48
BspPI	GGATC	4 cut(s)	83, 271, 383, 460
BssECI	CCNNGG	1 cut(s)	92
BssMI	GATC	6 cut(s)	88, 184, 263, 373, 388, 452
BssT1I	CCWWGG	1 cut(s)	92
Bst4CI	ACNGT	1 cut(s)	449
BstDEI	CTNAG	2 cut(s)	79, 132
BstEII	GGTNACC	1 cut(s)	253
BstENI	CCTNNNNNAGG	1 cut(s)	397
BstF5I	GGATG	2 cut(s)	18, 151
BstKTI	GATC	6 cut(s)	91, 187, 266, 376, 391, 455
BstMBI	GATC	6 cut(s)	88, 184, 263, 373, 388, 452
BstPI	GGTNACC	1 cut(s)	253
BstV1I	GCAGC	1 cut(s)	227
BstX2I	RGATCY	1 cut(s)	184
BstYI	RGATCY	1 cut(s)	184
Bsu15I	ATCGAT	1 cut(s)	48
BsuRI	GGCC	2 cut(s)	305, 403
BsuTUI	ATCGAT	1 cut(s)	48
BtsCI	GGATG	2 cut(s)	18, 151
BtsI	GCAGTG	1 cut(s)	12
BtsIMutI	CAGTG	2 cut(s)	12, 454
ClaI	ATCGAT	1 cut(s)	48
CviAII	CATG	1 cut(s)	142
CviJI	RGCY	7 cut(s)	103, 158, 197, 218, 233, 305, 403
CviKI_1	RGCY	7 cut(s)	103, 158, 197, 218, 233, 305, 403
DdeI	CTNAG	2 cut(s)	79, 132
DpnI	GATC	6 cut(s)	90, 186, 265, 375, 390, 454
DpnII	GATC	6 cut(s)	88, 184, 263, 373, 388, 452
DraI	TTTAAA	1 cut(s)	432
EaeI	YGGCCR	1 cut(s)	303
Eco130I	CCWWGG	1 cut(s)	92
Eco147I	AGGCCT	1 cut(s)	403
Eco91I	GGTNACC	1 cut(s)	253
EcoNI	CCTNNNNNAGG	1 cut(s)	397
EcoO65I	GGTNACC	1 cut(s)	253
EcoRI	GAATTC	1 cut(s)	226
EcoT14I	CCWWGG	1 cut(s)	92
ErhI	CCWWGG	1 cut(s)	92
FaeI	CATG	1 cut(s)	145
FaiI	YATR	6 cut(s)	99, 120, 143, 211, 213, 281
FatI	CATG	1 cut(s)	141
FauNDI	CATATG	1 cut(s)	211
FbaI	TGATCA	1 cut(s)	373
Fnu4HI	GCNGC	1 cut(s)	216
FokI	GGATG	2 cut(s)	25, 158
Fsp4HI	GCNGC	1 cut(s)	216
FspBI	CTAG	4 cut(s)	93, 191, 291, 493
GluI	GCNGC	1 cut(s)	216
HaeIII	GGCC	2 cut(s)	305, 403
Hin1II	CATG	1 cut(s)	145
HphI	GGTGA	2 cut(s)	164, 247
Hpy188III	TCNNGA	2 cut(s)	86, 397
HpyAV	CCTTC	2 cut(s)	244, 403
HpyCH4III	ACNGT	1 cut(s)	449
HpyCH4V	TGCA	3 cut(s)	126, 215, 471
HpyF3I	CTNAG	2 cut(s)	79, 132
Hsp92II	CATG	1 cut(s)	145
Ksp22I	TGATCA	1 cut(s)	373
Kzo9I	GATC	6 cut(s)	88, 184, 263, 373, 388, 452
LpnPI	CCDG	1 cut(s)	261
Lsp1109I	GCAGC	1 cut(s)	227
MaeI	CTAG	4 cut(s)	93, 191, 291, 493
MaeIII	GTNAC	1 cut(s)	253
MalI	GATC	6 cut(s)	90, 186, 265, 375, 390, 454
MboI	GATC	6 cut(s)	88, 184, 263, 373, 388, 452
MboII	GAAGA	1 cut(s)	28
MflI	RGATCY	1 cut(s)	184
MluCI	AATT	6 cut(s)	109, 226, 319, 351, 426, 433
MnlI	CCTC	5 cut(s)	3, 159, 244, 261, 393
MseI	TTAA	1 cut(s)	431
Mva1269I	GAATGC	1 cut(s)	271
NdeI	CATATG	1 cut(s)	211
NdeII	GATC	6 cut(s)	88, 184, 263, 373, 388, 452
NlaIII	CATG	1 cut(s)	145
NmuCI	GTSAC	1 cut(s)	253
PceI	AGGCCT	1 cut(s)	403
PctI	GAATGC	1 cut(s)	271
PkrI	GCNGC	1 cut(s)	217
PspEI	GGTNACC	1 cut(s)	253
PsuI	RGATCY	1 cut(s)	184
SaqAI	TTAA	1 cut(s)	431
SatI	GCNGC	1 cut(s)	216
Sau3AI	GATC	6 cut(s)	88, 184, 263, 373, 388, 452
SetI	ASST	7 cut(s)	98, 105, 160, 180, 220, 255, 422
SmlI	CTYRAG	1 cut(s)	335
SmoI	CTYRAG	1 cut(s)	335
Sse9I	AATT	6 cut(s)	109, 226, 319, 351, 426, 433
SseBI	AGGCCT	1 cut(s)	403
SspI	AATATT	1 cut(s)	35
SspMI	CTAG	4 cut(s)	93, 191, 291, 493
StuI	AGGCCT	1 cut(s)	403
StyI	CCWWGG	1 cut(s)	92
TaaI	ACNGT	1 cut(s)	449
TaqI	TCGA	4 cut(s)	48, 266, 396, 455
TasI	AATT	6 cut(s)	109, 226, 319, 351, 426, 433
Tru1I	TTAA	1 cut(s)	431
Tru9I	TTAA	1 cut(s)	431
TscAI	CASTG	2 cut(s)	12, 454
TseFI	GTSAC	1 cut(s)	253
TseI	GCWGC	1 cut(s)	215
Tsp45I	GTSAC	1 cut(s)	253
TspDTI	ATGAA	2 cut(s)	29, 239
TspRI	CASTG	2 cut(s)	12, 454
XagI	CCTNNNNNAGG	1 cut(s)	397
XapI	RAATTY	3 cut(s)	109, 226, 426
XmaJI	CCTAGG	1 cut(s)	92
XspI	CTAG	4 cut(s)	93, 191, 291, 493

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.