Rmu_sc0001287.1_g000031

protein dimerization activity

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001287.1
OG0017594
Physical Location & Seq
Forward (+)
154485 .. 154787
303 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001287.1_g000031.1.cds

Sequence Viewer

Length: 303 bp
atggatggagttacagttaagaagaagagtgaagaactcaaggagttggtggtggcacttaccgatttgtatgcgtcttcaaatggtaatcagaaagccaaaagtagccaagaaagtggtatcactggtggaagcacatctagtacaaggacagtgagtggcaagagggtagatatgatgaatgattggagaaaagaactagaggaatcagaggaggtggttgtgcaacatgaagtggacaggtactgtcttgatccaattgatggaacctttgatgatgatgaatttgacattttgttgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF4413

Protein Analysis

100

Amino Acids

11.13

Weight (kDa)

4.43

Isoelectric Point (pI)

38.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 263
AclWI GGATC 1 cut(s) 248
AcsI RAATTY 1 cut(s) 284
AfaI GTAC 2 cut(s) 145, 245
AfiI CCNNNNNNNGG 1 cut(s) 263
AgsI TTSAA 1 cut(s) 81
AlwI GGATC 1 cut(s) 248
AlwNI CAGNNNCTG 1 cut(s) 246
ApoI RAATTY 1 cut(s) 284
BbsI GAAGAC 1 cut(s) 69
BccI CCATC 1 cut(s) 257
BcgI CGANNNNNNTGC 2 cut(s) 53, 87
BfaI CTAG 2 cut(s) 141, 200
BmiI GGNNCC 1 cut(s) 268
BpiI GAAGAC 1 cut(s) 69
BpuEI CTTGAG 1 cut(s) 23
BsaXI ACNNNNNCTCC 1 cut(s) 30
Bsc4I CCNNNNNNNGG 1 cut(s) 263
Bse1I ACTGG 1 cut(s) 130
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 1 cut(s) 263
BseNI ACTGG 1 cut(s) 130
BseRI GAGGAG 1 cut(s) 227
BslI CCNNNNNNNGG 1 cut(s) 263
Bsp143I GATC 1 cut(s) 253
BspLI GGNNCC 1 cut(s) 268
BspPI GGATC 1 cut(s) 248
BsrI ACTGG 1 cut(s) 130
BssMI GATC 1 cut(s) 253
Bst4CI ACNGT 3 cut(s) 16, 154, 248
Bst6I CTCTTC 1 cut(s) 20
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 1 cut(s) 256
BstMBI GATC 1 cut(s) 253
BstV2I GAAGAC 1 cut(s) 69
BstXI CCANNNNNNTGG 1 cut(s) 116
BtsCI GGATG 1 cut(s) 10
BtsIMutI CAGTG 2 cut(s) 123, 159
CaiI CAGNNNCTG 1 cut(s) 246
CseI GACGC 1 cut(s) 63
Csp6I GTAC 2 cut(s) 144, 244
CviAII CATG 1 cut(s) 230
CviJI RGCY 2 cut(s) 98, 108
CviKI_1 RGCY 2 cut(s) 98, 108
CviQI GTAC 2 cut(s) 144, 244
DpnI GATC 1 cut(s) 255
DpnII GATC 1 cut(s) 253
Eam1104I CTCTTC 1 cut(s) 20
EarI CTCTTC 1 cut(s) 20
FaeI CATG 1 cut(s) 233
FaiI YATR 3 cut(s) 72, 176, 231
FatI CATG 1 cut(s) 229
FokI GGATG 1 cut(s) 17
FspBI CTAG 2 cut(s) 141, 200
HgaI GACGC 1 cut(s) 63
Hin1II CATG 1 cut(s) 233
HinfI GANTC 1 cut(s) 206
Hpy166II GTNNAC 1 cut(s) 238
Hpy188I TCNGA 2 cut(s) 93, 211
Hpy188III TCNNGA 1 cut(s) 251
Hpy8I GTNNAC 1 cut(s) 238
HpyCH4III ACNGT 3 cut(s) 16, 154, 248
HpyCH4V TGCA 1 cut(s) 226
Hsp92II CATG 1 cut(s) 233
Kzo9I GATC 1 cut(s) 253
LpnPI CCDG 2 cut(s) 111, 226
MaeI CTAG 2 cut(s) 141, 200
MaeIII GTNAC 1 cut(s) 10
MalI GATC 1 cut(s) 255
MboI GATC 1 cut(s) 253
MboII GAAGA 4 cut(s) 34, 37, 44, 69
MfeI CAATTG 1 cut(s) 258
MluCI AATT 2 cut(s) 258, 284
MnlI CCTC 4 cut(s) 159, 196, 205, 208
MseI TTAA 1 cut(s) 18
MunI CAATTG 1 cut(s) 258
NdeII GATC 1 cut(s) 253
NlaIII CATG 1 cut(s) 233
NlaIV GGNNCC 1 cut(s) 268
PfeI GAWTC 1 cut(s) 206
PflMI CCANNNNNTGG 1 cut(s) 263
PspN4I GGNNCC 1 cut(s) 268
PstNI CAGNNNCTG 1 cut(s) 246
RsaI GTAC 2 cut(s) 145, 245
RsaNI GTAC 2 cut(s) 144, 244
SaqAI TTAA 1 cut(s) 18
Sau3AI GATC 1 cut(s) 253
SetI ASST 3 cut(s) 219, 245, 272
SmlI CTYRAG 1 cut(s) 38
SmoI CTYRAG 1 cut(s) 38
Sse9I AATT 2 cut(s) 258, 284
SspMI CTAG 2 cut(s) 141, 200
TaaI ACNGT 3 cut(s) 16, 154, 248
TasI AATT 2 cut(s) 258, 284
TatI WGTACW 1 cut(s) 143
TfiI GAWTC 1 cut(s) 206
Tru1I TTAA 1 cut(s) 18
Tru9I TTAA 1 cut(s) 18
TscAI CASTG 2 cut(s) 130, 159
TspDTI ATGAA 3 cut(s) 194, 246, 297
TspRI CASTG 2 cut(s) 130, 159
Van91I CCANNNNNTGG 1 cut(s) 263
XapI RAATTY 1 cut(s) 284
XspI CTAG 2 cut(s) 141, 200
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.