Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001232.1

Orthogroup ID

OG0008155

Physical Location & Seq

Genomic Coordinates Reverse (-)

91927 .. 93964

Gene Structure 2038 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001232.1_g000023.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1140 bp

atgacgaactttgctaagctgaaccaggcaacggggtttcagagatcatcaacatctgataagcaaaaggtgcaacctatcagtacaaaagtagtaaagaacgacgagaacagtggtgatctttccttggcatcaatagcctcaaacctgcatgatatttctaccattgttaatacacctatcccctcatcagatatagcttatagttcatgggtggtggagcacccttctgcactaggctcatttgacaggatgatgaaagctgcaaaagggaagaggattgttgtctttttagactatgacggcaccctttcaccgattgttgatgatccggatcgtgctttcatgtccaatgagatgcgtgcagcagtacgcgaagttgccaaatattttccaacagcagtaatcagtgggaggagtagagacaaggtaaaaggatttgtacaattaagtaatgtatattatgccggcagccatgggatggacattatggtccctccaaagccactaaagccctgtgatgccaagaaccacgtcacagccacagcctcagccttggataaggagggtgacatgctctttcaacctgccaaaagattcctgcctgcaatccaagagataagcatagcgttggaggaaatagcaagaaagatagaaggtgcaagagtagaggacaatagattctgcatctctgtgcattaccggaaggtccgggaagaggattatggcatattagaagaaaaggtgaagtctgtgattgaaaactatcctgattttcacctaactcggggtaaaaaggtcctggagatacgtccatctatagaatggaacaaaggtcatgcgcttgaatatttacttgacactcttggattcagtaattcgggtgatgtattcccattgtacatcggggatgatcgaacggatgaagatgctttcaaggtgattgaagccagaggacagggatttccaataatcgtgtcttccatcccaaaggacaccaaagctgctttttctctgcacgatccatcagaagtgttgactttcttgttacgccttgcaaggtggagaaaaacctcgtcttcgagcaggtcactcgctcaaatttggggtcctgggaattcacataaggccaattgctag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00500 ko01100 map00500 map01100

Pfam Domains

Protein Families

Trehalose_PPase

Protein Analysis

379

Amino Acids

42.14

Weight (kDa)

8.24

Isoelectric Point (pI)

35.48

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008155)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_7g31160 FvH4_7g31160 FvH4_7g31160 FvH4_7g31160 FvH4_7g31160
malus_domestica	MD01G1216200.v1.1 MD07G1286100.v1.1
prunus_persica	Prupe.2G308300_v2.0.a1 Prupe.2G308300_v2.0.a1 Prupe.2G308300_v2.0.a1 Prupe.2G308300_v2.0.a1
pyrus_communis	pycom01g22700 pycom07g25940
rosa_chinensis	RchiOBHm_Chr1g0380201
rosa_laevigata	RLG00000026320
rosa_multiflora	Rmu_sc0001232.1_g000023
rosa_roxburghii	Rroxscaffold_4G00279570
rosa_rugosa	Rorug01G0418900
rosa_samantha	Rh1AG443800 Rh1BG398800 Rh1CG412200 Rh1DG429400
rosa_wichuraiana	Rw1G038540 Rw1G038610

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	1 cut(s)	491
Acc36I	ACCTGC	3 cut(s)	156, 595, 1077
AccB1I	GGYRCC	1 cut(s)	305
AccB7I	CCANNNNNTGG	1 cut(s)	481
AccII	CGCG	1 cut(s)	375
AccIII	TCCGGA	1 cut(s)	331
AclWI	GGATC	3 cut(s)	323, 342, 1016
AcsI	RAATTY	2 cut(s)	1101, 1117
AfaI	GTAC	4 cut(s)	85, 372, 444, 902
AfiI	CCNNNNNNNGG	4 cut(s)	31, 481, 718, 787
AgsI	TTSAA	5 cut(s)	584, 761, 848, 937, 947
AjiI	CACGTC	1 cut(s)	535
AjnI	CCWGG	3 cut(s)	24, 801, 1111
AluBI	AGCT	4 cut(s)	19, 200, 263, 1004
AluI	AGCT	4 cut(s)	19, 200, 263, 1004
Alw21I	GWGCWC	1 cut(s)	225
Alw26I	GTCTC	1 cut(s)	417
AlwI	GGATC	3 cut(s)	323, 342, 1016
Ama87I	CYCGRG	1 cut(s)	786
Aor13HI	TCCGGA	1 cut(s)	331
AoxI	GGCC	1 cut(s)	1128
ApeKI	GCWGC	4 cut(s)	263, 365, 471, 1004
ApoI	RAATTY	2 cut(s)	1101, 1117
ArsI	GACNNNNNNTTYG	2 cut(s)	1093, 1125
AspLEI	GCGC	1 cut(s)	844
AspS9I	GGNCC	4 cut(s)	493, 709, 799, 1109
AsuC2I	CCSGG	1 cut(s)	713
AsuHPI	GGTGA	7 cut(s)	128, 306, 581, 757, 770, 896, 952
AvaI	CYCGRG	1 cut(s)	786
AvaII	GGWCC	4 cut(s)	493, 709, 799, 1109
BanI	GGYRCC	1 cut(s)	305
BbsI	GAAGAC	2 cut(s)	972, 1071
Bbv12I	GWGCWC	1 cut(s)	225
BbvCI	CCTCAGC	1 cut(s)	550
BbvI	GCAGC	4 cut(s)	250, 377, 483, 991
BccI	CCATC	4 cut(s)	475, 823, 992, 1033
BceAI	ACGGC	1 cut(s)	319
BcgI	CGANNNNNNTGC	2 cut(s)	1075, 1109
BciT130I	CCWGG	3 cut(s)	26, 803, 1113
BcnI	CCSGG	1 cut(s)	713
BcoDI	GTCTC	1 cut(s)	417
BfaI	CTAG	2 cut(s)	236, 1138
BfmI	CTRYAG	1 cut(s)	819
BfuAI	ACCTGC	3 cut(s)	156, 595, 1077
BisI	GCNGC	4 cut(s)	264, 366, 472, 1005
BlpI	GCTNAGC	1 cut(s)	15
BlsI	GCNGC	4 cut(s)	265, 367, 473, 1006
Bme1390I	CCNGG	4 cut(s)	26, 713, 803, 1113
Bme18I	GGWCC	4 cut(s)	493, 709, 799, 1109
BmeT110I	CYCGRG	1 cut(s)	786
BmgBI	CACGTC	1 cut(s)	535
BmgT120I	GGNCC	4 cut(s)	493, 709, 799, 1109
BmiI	GGNNCC	3 cut(s)	307, 495, 1110
BmrFI	CCNGG	4 cut(s)	26, 713, 803, 1113
BmsI	GCATC	5 cut(s)	140, 348, 511, 696, 919
BpiI	GAAGAC	2 cut(s)	972, 1071
BpmI	CTGGAG	1 cut(s)	824
Bpu10I	CCTNAGC	1 cut(s)	550
Bpu1102I	GCTNAGC	1 cut(s)	15
BpuMI	CCSGG	1 cut(s)	713
BsaBI	GATNNNNATC	1 cut(s)	333
BsaJI	CCNNGG	4 cut(s)	126, 475, 555, 1112
BsaWI	WCCGGW	2 cut(s)	331, 702
Bsc4I	CCNNNNNNNGG	4 cut(s)	31, 481, 718, 787
Bse118I	RCCGGY	1 cut(s)	467
Bse8I	GATNNNNATC	1 cut(s)	333
BseAI	TCCGGA	1 cut(s)	331
BseBI	CCWGG	3 cut(s)	26, 803, 1113
BseDI	CCNNGG	4 cut(s)	126, 475, 555, 1112
BseGI	GGATG	5 cut(s)	258, 486, 916, 928, 984
BseJI	GATNNNNATC	1 cut(s)	333
BseLI	CCNNNNNNNGG	4 cut(s)	31, 481, 718, 787
BseMII	CTCAG	1 cut(s)	564
BseRI	GAGGAG	1 cut(s)	430
BseXI	GCAGC	4 cut(s)	250, 377, 483, 991
BsgI	GTGCAG	3 cut(s)	216, 384, 1001
Bsh1236I	CGCG	1 cut(s)	375
BshFI	GGCC	1 cut(s)	1130
BshNI	GGYRCC	1 cut(s)	305
BsiHKAI	GWGCWC	1 cut(s)	225
BsiHKCI	CYCGRG	1 cut(s)	786
BsiSI	CCGG	4 cut(s)	332, 468, 703, 712
BslFI	GGGAC	1 cut(s)	479
BslI	CCNNNNNNNGG	4 cut(s)	31, 481, 718, 787
BsmAI	GTCTC	1 cut(s)	417
BsmFI	GGGAC	1 cut(s)	479
BsnI	GGCC	1 cut(s)	1130
BsoBI	CYCGRG	1 cut(s)	786
Bsp1286I	GDGCHC	1 cut(s)	225
Bsp13I	TCCGGA	1 cut(s)	331
Bsp1407I	TGTACA	2 cut(s)	442, 900
Bsp143I	GATC	6 cut(s)	44, 118, 328, 334, 913, 1021
Bsp1720I	GCTNAGC	1 cut(s)	15
Bsp19I	CCATGG	1 cut(s)	475
BspANI	GGCC	1 cut(s)	1130
BspCNI	CTCAG	1 cut(s)	563
BspEI	TCCGGA	1 cut(s)	331
BspFNI	CGCG	1 cut(s)	375
BspLI	GGNNCC	3 cut(s)	307, 495, 1110
BspMI	ACCTGC	3 cut(s)	156, 595, 1077
BspPI	GGATC	3 cut(s)	323, 342, 1016
BspT107I	GGYRCC	1 cut(s)	305
BsrFI	RCCGGY	1 cut(s)	467
BsrGI	TGTACA	2 cut(s)	442, 900
BssAI	RCCGGY	1 cut(s)	467
BssECI	CCNNGG	4 cut(s)	126, 475, 555, 1112
BssMI	GATC	6 cut(s)	44, 118, 328, 334, 913, 1021
BssT1I	CCWWGG	3 cut(s)	126, 475, 555
Bst2UI	CCWGG	3 cut(s)	26, 803, 1113
Bst4CI	ACNGT	1 cut(s)	113
Bst6I	CTCTTC	2 cut(s)	269, 711
BstAPI	GCANNNNNTGC	1 cut(s)	70
BstAUI	TGTACA	2 cut(s)	442, 900
BstC8I	GCNNGC	3 cut(s)	363, 469, 606
BstDEI	CTNAG	2 cut(s)	15, 550
BstDSI	CCRYGG	1 cut(s)	475
BstF5I	GGATG	5 cut(s)	258, 486, 916, 928, 984
BstFNI	CGCG	1 cut(s)	375
BstHHI	GCGC	1 cut(s)	844
BstKTI	GATC	6 cut(s)	47, 121, 331, 337, 916, 1024
BstMAI	GTCTC	1 cut(s)	417
BstMBI	GATC	6 cut(s)	44, 118, 328, 334, 913, 1021
BstMWI	GCNNNNNNNGC	3 cut(s)	70, 137, 511
BstNI	CCWGG	3 cut(s)	26, 803, 1113
BstNSI	RCATGY	1 cut(s)	577
BstSCI	CCNGG	4 cut(s)	24, 711, 801, 1111
BstSFI	CTRYAG	1 cut(s)	819
BstUI	CGCG	1 cut(s)	375
BstV1I	GCAGC	4 cut(s)	250, 377, 483, 991
BstV2I	GAAGAC	2 cut(s)	972, 1071
BsuRI	GGCC	1 cut(s)	1130
BtgI	CCRYGG	1 cut(s)	475
BtrI	CACGTC	1 cut(s)	535
BtsCI	GGATG	5 cut(s)	258, 486, 916, 928, 984
BtsIMutI	CAGTG	2 cut(s)	118, 415
BveI	ACCTGC	3 cut(s)	156, 595, 1077
Cac8I	GCNNGC	3 cut(s)	363, 469, 606
CfoI	GCGC	1 cut(s)	844
Cfr10I	RCCGGY	1 cut(s)	467
Cfr13I	GGNCC	4 cut(s)	493, 709, 799, 1109
Csp6I	GTAC	4 cut(s)	84, 371, 443, 901
CviAII	CATG	6 cut(s)	152, 210, 346, 476, 574, 839
CviQI	GTAC	4 cut(s)	84, 371, 443, 901
DdeI	CTNAG	2 cut(s)	15, 550
DpnI	GATC	6 cut(s)	46, 120, 330, 336, 915, 1023
DpnII	GATC	6 cut(s)	44, 118, 328, 334, 913, 1021
DrdI	GACNNNNNNGTC	1 cut(s)	491
DseDI	GACNNNNNNGTC	1 cut(s)	491
Eam1104I	CTCTTC	2 cut(s)	269, 711
EarI	CTCTTC	2 cut(s)	269, 711
Eco130I	CCWWGG	3 cut(s)	126, 475, 555
Eco47I	GGWCC	4 cut(s)	493, 709, 799, 1109
Eco88I	CYCGRG	1 cut(s)	786
EcoO109I	RGGNCCY	2 cut(s)	799, 1109
EcoRI	GAATTC	1 cut(s)	1117
EcoRII	CCWGG	3 cut(s)	24, 801, 1111
EcoT14I	CCWWGG	3 cut(s)	126, 475, 555
ErhI	CCWWGG	3 cut(s)	126, 475, 555
FaeI	CATG	6 cut(s)	155, 213, 349, 479, 577, 842
FaqI	GGGAC	1 cut(s)	479
FatI	CATG	6 cut(s)	151, 209, 345, 475, 573, 838
Fnu4HI	GCNGC	4 cut(s)	264, 366, 472, 1005
FokI	GGATG	5 cut(s)	265, 493, 923, 935, 971
Fsp4HI	GCNGC	4 cut(s)	264, 366, 472, 1005
FspBI	CTAG	2 cut(s)	236, 1138
GlaI	GCGC	1 cut(s)	843
GluI	GCNGC	4 cut(s)	264, 366, 472, 1005
GsuI	CTGGAG	1 cut(s)	824
HaeIII	GGCC	1 cut(s)	1130
HapII	CCGG	4 cut(s)	332, 468, 703, 712
HhaI	GCGC	1 cut(s)	844
Hin1II	CATG	6 cut(s)	155, 213, 349, 479, 577, 842
Hin6I	GCGC	1 cut(s)	842
HinP1I	GCGC	1 cut(s)	842
HincII	GTYRAC	1 cut(s)	1038
HindII	GTYRAC	1 cut(s)	1038
HinfI	GANTC	3 cut(s)	597, 681, 870
HpaII	CCGG	4 cut(s)	332, 468, 703, 712
HphI	GGTGA	7 cut(s)	128, 306, 581, 757, 770, 896, 952
Hpy166II	GTNNAC	1 cut(s)	1038
Hpy188I	TCNGA	4 cut(s)	42, 58, 193, 1030
Hpy188III	TCNNGA	2 cut(s)	332, 770
Hpy8I	GTNNAC	1 cut(s)	1038
Hpy99I	CGWCG	1 cut(s)	107
HpyAV	CCTTC	3 cut(s)	237, 650, 700
HpyCH4III	ACNGT	1 cut(s)	113
HpyCH4IV	ACGT	2 cut(s)	534, 811
HpyF10VI	GCNNNNNNNGC	3 cut(s)	70, 137, 511
HpyF3I	CTNAG	2 cut(s)	15, 550
HpySE526I	ACGT	2 cut(s)	534, 811
Hsp92II	CATG	6 cut(s)	155, 213, 349, 479, 577, 842
HspAI	GCGC	1 cut(s)	842
Kpn2I	TCCGGA	1 cut(s)	331
KroI	GCCGGC	1 cut(s)	467
KroNI	GCCGGC	1 cut(s)	469
Kzo9I	GATC	6 cut(s)	44, 118, 328, 334, 913, 1021
LmnI	GCTCC	1 cut(s)	220
Lsp1109I	GCAGC	4 cut(s)	250, 377, 483, 991
LweI	GCATC	5 cut(s)	140, 348, 511, 696, 919
MaeI	CTAG	2 cut(s)	236, 1138
MaeII	ACGT	2 cut(s)	534, 811
MaeIII	GTNAC	4 cut(s)	535, 569, 1047, 1089
MalI	GATC	6 cut(s)	46, 120, 330, 336, 915, 1023
MboI	GATC	6 cut(s)	44, 118, 328, 334, 913, 1021
MboII	GAAGA	6 cut(s)	286, 728, 749, 938, 972, 1071
MfeI	CAATTG	1 cut(s)	1132
MhlI	GDGCHC	1 cut(s)	225
MluCI	AATT	5 cut(s)	446, 877, 1101, 1117, 1132
MmeI	TCCRAC	2 cut(s)	419, 612
MroI	TCCGGA	1 cut(s)	331
MroNI	GCCGGC	1 cut(s)	467
MseI	TTAA	2 cut(s)	171, 449
MslI	CAYNNNNRTG	1 cut(s)	692
MspI	CCGG	4 cut(s)	332, 468, 703, 712
MspR9I	CCNGG	4 cut(s)	26, 713, 803, 1113
MunI	CAATTG	1 cut(s)	1132
MvaI	CCWGG	3 cut(s)	26, 803, 1113
MvnI	CGCG	1 cut(s)	375
MwoI	GCNNNNNNNGC	3 cut(s)	70, 137, 511
NaeI	GCCGGC	1 cut(s)	469
NciI	CCSGG	1 cut(s)	713
NcoI	CCATGG	1 cut(s)	475
NdeII	GATC	6 cut(s)	44, 118, 328, 334, 913, 1021
NgoMIV	GCCGGC	1 cut(s)	467
NlaIII	CATG	6 cut(s)	155, 213, 349, 479, 577, 842
NlaIV	GGNNCC	3 cut(s)	307, 495, 1110
NmuCI	GTSAC	3 cut(s)	535, 569, 1089
NspI	RCATGY	1 cut(s)	577
PdiI	GCCGGC	1 cut(s)	469
PfeI	GAWTC	3 cut(s)	597, 681, 870
PflMI	CCANNNNNTGG	1 cut(s)	481
PfoI	TCCNGGA	2 cut(s)	711, 801
PkrI	GCNGC	4 cut(s)	265, 367, 473, 1006
PpuMI	RGGWCCY	2 cut(s)	799, 1109
Psp5II	RGGWCCY	2 cut(s)	799, 1109
Psp6I	CCWGG	3 cut(s)	24, 801, 1111
PspGI	CCWGG	3 cut(s)	24, 801, 1111
PspN4I	GGNNCC	3 cut(s)	307, 495, 1110
PspPI	GGNCC	4 cut(s)	493, 709, 799, 1109
PspPPI	RGGWCCY	2 cut(s)	799, 1109
RsaI	GTAC	4 cut(s)	85, 372, 444, 902
RsaNI	GTAC	4 cut(s)	84, 371, 443, 901
RseI	CAYNNNNRTG	1 cut(s)	692
SaqAI	TTAA	2 cut(s)	171, 449
SatI	GCNGC	4 cut(s)	264, 366, 472, 1005
Sau3AI	GATC	6 cut(s)	44, 118, 328, 334, 913, 1021
Sau96I	GGNCC	4 cut(s)	493, 709, 799, 1109
ScrFI	CCNGG	4 cut(s)	26, 713, 803, 1113
SduI	GDGCHC	1 cut(s)	225
SfaNI	GCATC	5 cut(s)	140, 348, 511, 696, 919
SfcI	CTRYAG	1 cut(s)	819
SinI	GGWCC	4 cut(s)	493, 709, 799, 1109
SmiMI	CAYNNNNRTG	1 cut(s)	692
Sse9I	AATT	5 cut(s)	446, 877, 1101, 1117, 1132
SspI	AATATT	2 cut(s)	389, 851
SspMI	CTAG	2 cut(s)	236, 1138
StyD4I	CCNGG	4 cut(s)	24, 711, 801, 1111
StyI	CCWWGG	3 cut(s)	126, 475, 555
TaaI	ACNGT	1 cut(s)	113
TaiI	ACGT	2 cut(s)	537, 814
TaqI	TCGA	2 cut(s)	916, 1082
TasI	AATT	5 cut(s)	446, 877, 1101, 1117, 1132
TatI	WGTACW	3 cut(s)	83, 442, 900
TfiI	GAWTC	3 cut(s)	597, 681, 870
Tru1I	TTAA	2 cut(s)	171, 449
Tru9I	TTAA	2 cut(s)	171, 449
TscAI	CASTG	2 cut(s)	118, 415
TseFI	GTSAC	3 cut(s)	535, 569, 1089
TseI	GCWGC	4 cut(s)	263, 365, 471, 1004
Tsp45I	GTSAC	3 cut(s)	535, 569, 1089
TspDTI	ATGAA	4 cut(s)	198, 272, 334, 939
TspGWI	ACGGA	1 cut(s)	935
TspRI	CASTG	2 cut(s)	118, 415
Van91I	CCANNNNNTGG	1 cut(s)	481
VpaK11BI	GGWCC	4 cut(s)	493, 709, 799, 1109
XapI	RAATTY	2 cut(s)	1101, 1117
XceI	RCATGY	1 cut(s)	577
XcmI	CCANNNNNNNNNTGG	1 cut(s)	822
XspI	CTAG	2 cut(s)	236, 1138

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.