Rmu_sc0001381.1_g000013

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001381.1
Physical Location & Seq
Forward (+)
35774 .. 41001
5228 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001381.1_g000013.1.cds

Sequence Viewer

Length: 2013 bp
atgttcaatcggctagcgaatttgcatatgacaggcctgttcactcttatatcgactttgatttccattttgatgatcgagaatctgttacaactctctttcattcgttccgtgtctcagcttttctccgaaactgcaactatggagtccatttccttaaggcatgcaatctctgcaacacatcacacctatctcaggagaacaagagtaaacccagaaaagccatttcagacaaaaaggtttcaccttcacaacccaactggccgttttcaaatccattccaaactctctgatttccaagactatgcaaagccttcatgcctattgcaagccacagaagtgaatgtctgcacagatacgtcagtggaaaaaagcttcttgtcattaagggattatgaatgtcaggctttatataaggtcaagctaggtactagtaatgcttatggttcaagtctctccgaccttactgctggaatcctcctgtgcgtgatagacgaaaatggtaactccatactacagaggataccctcgaatttgagaccggatgaatctaaagaagtagaggatgagataattcagtttcaaagaggttctgttgatgagttcacctttaagggacctaaacttggaaaagttgaagctctttggatcagtcttgaatcaggccaatggaggttaggaagtgtgaacttgactgttatatatgggaatcatatttctttggaggaaacagatggagaggaacctcagtatattggtttcgattacaacttccaagctgaggacatcttgctcggagagggaagtgacagctccatggtggaacttagaccttgccttgtcaccaagctatctggggttgaccccttcaccatgttgactaaaagcctccctgaatccactctatccgagagccatgggatatcaaatgaggaaaccatgagagaatacgctgatttgaagttctctttgctactttacgatgccatactggtcttggttggtacatcagttgcatccttttcagttggggaaaatgccggttctgcatttttaacaggtgggattggtggcttcttgtatcttcttctactgcagaggtcagttgatggattacctattccagaatcaatttccgtggacagcaaaagcaccaatcaaatgtttggaggaatgaagaggccaatctttggccttgcattggctcttggttttgctttatttacagtgaagtatagctctggggatgtcccaatggttttcacagcaaaagaagtcttggctgggatggtgggatttcttgcatgccaatggaggttaggaagtgtgaacttgactgttatatatgggaatcatatttctttggaggaaacagatggagaggaacctcagtatattggtttcgattacaacttccaagctgaggacatcttgctcggagagggaagtgacagctccatggtggaacttagaccttgccttgtcaccaagctatctggggttgaccccttcaccatgttgactaaaagcctccctgaatcaactctatccgagagccgtgggatatcaaatgaggaaaccatgagagaatacgcggatttgaagttctctttgctactttacgatgccatactggtcttggttggtacatcagttgcatccttttcagttggggaaaatgccggttctgcatttttaacaggtgggattggtggcttcttgtatcttcttctactgcagaggtcagttgatggattacctattccagaatcaatttccgtggacagcaaaagcaccaatcaaatgtttggaggaatgaagaggccaatctttggccttgcattggctcttggttttgctttatttacagtgaagtatagctctggggatgtcccaatggttttcacagcaaaagaagtcttggctgggatggtgggatttcttgcatgtaaagttgctgtggttttggcagcaattaagcccatgacaatagacctaaagataaaagactga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

670

Amino Acids

73.26

Weight (kDa)

4.94

Isoelectric Point (pI)

36.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013150)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 1190, 1832
AccII CGCG 1 cut(s) 1595
AciI CCGC 1 cut(s) 1595
AclWI GGATC 1 cut(s) 656
AcoI YGGCCR 1 cut(s) 262
AcsI RAATTY 2 cut(s) 19, 532
AfaI GTAC 3 cut(s) 430, 1006, 1648
AfiI CCNNNNNNNGG 8 cut(s) 195, 626, 781, 1190, 1201, 1423, 1832, 1843
AflII CTTAAG 1 cut(s) 157
AgsI TTSAA 8 cut(s) 7, 272, 450, 584, 638, 659, 961, 1603
AhlI ACTAGT 1 cut(s) 431
AleI CACNNNNGTG 1 cut(s) 338
AloI GAACNNNNNNTCC 2 cut(s) 1589, 1621
Alw26I GTCTC 3 cut(s) 120, 458, 532
AlwI GGATC 1 cut(s) 656
AoxI GGCC 7 cut(s) 34, 262, 664, 1181, 1192, 1823, 1834
ApeKI GCWGC 1 cut(s) 1970
ApoI RAATTY 2 cut(s) 19, 532
AspS9I GGNCC 1 cut(s) 617
AsuHPI GGTGA 6 cut(s) 236, 598, 835, 862, 1477, 1504
AsuNHI GCTAGC 1 cut(s) 13
AvaII GGWCC 1 cut(s) 617
BaeI ACNNNNGTAYC 6 cut(s) 348, 381, 996, 1029, 1638, 1671
BbvCI CCTCAGC 2 cut(s) 780, 1422
BbvI GCAGC 1 cut(s) 1982
BccI CCATC 6 cut(s) 728, 1103, 1282, 1370, 1745, 1924
BceAI ACGGC 2 cut(s) 249, 1542
BcgI CGANNNNNNTGC 2 cut(s) 449, 483
BciVI GTATCC 1 cut(s) 516
BcoDI GTCTC 3 cut(s) 120, 458, 532
BcuI ACTAGT 1 cut(s) 431
BfaI CTAG 3 cut(s) 14, 425, 432
BfmI CTRYAG 3 cut(s) 515, 1094, 1736
BfrI CTTAAG 1 cut(s) 157
BfuI GTATCC 1 cut(s) 516
BisI GCNGC 1 cut(s) 1971
BlsI GCNGC 1 cut(s) 1972
Bme18I GGWCC 1 cut(s) 617
BmgT120I GGNCC 1 cut(s) 617
BmiI GGNNCC 3 cut(s) 618, 744, 1386
BmsI GCATC 4 cut(s) 973, 1025, 1615, 1667
BmtI GCTAGC 1 cut(s) 17
Bpu10I CCTNAGC 2 cut(s) 780, 1422
BsaI GGTCTC 1 cut(s) 532
BsaJI CCNNGG 6 cut(s) 816, 916, 1137, 1458, 1558, 1779
BsaWI WCCGGW 1 cut(s) 541
Bsc4I CCNNNNNNNGG 8 cut(s) 195, 626, 781, 1190, 1201, 1423, 1832, 1843
Bse118I RCCGGY 2 cut(s) 1040, 1682
Bse1I ACTGG 3 cut(s) 265, 996, 1638
BseDI CCNNGG 6 cut(s) 816, 916, 1137, 1458, 1558, 1779
BseGI GGATG 8 cut(s) 550, 571, 1016, 1252, 1293, 1658, 1894, 1935
BseLI CCNNNNNNNGG 8 cut(s) 195, 626, 781, 1190, 1201, 1423, 1832, 1843
BseMII CTCAG 6 cut(s) 131, 208, 761, 771, 1403, 1413
BseNI ACTGG 3 cut(s) 265, 996, 1638
BseXI GCAGC 1 cut(s) 1982
BseYI CCCAGC 2 cut(s) 1283, 1925
BsgI GTGCAG 1 cut(s) 334
Bsh1236I CGCG 1 cut(s) 1595
BshFI GGCC 7 cut(s) 36, 264, 666, 1183, 1194, 1825, 1836
BsiSI CCGG 3 cut(s) 542, 1041, 1683
BslFI GGGAC 3 cut(s) 630, 1235, 1877
BslI CCNNNNNNNGG 8 cut(s) 195, 626, 781, 1190, 1201, 1423, 1832, 1843
BsmAI GTCTC 3 cut(s) 120, 458, 532
BsmFI GGGAC 3 cut(s) 630, 1235, 1877
BsnI GGCC 7 cut(s) 36, 264, 666, 1183, 1194, 1825, 1836
Bso31I GGTCTC 1 cut(s) 532
Bsp143I GATC 2 cut(s) 75, 648
Bsp19I CCATGG 3 cut(s) 816, 916, 1458
BspACI CCGC 1 cut(s) 1595
BspANI GGCC 7 cut(s) 36, 264, 666, 1183, 1194, 1825, 1836
BspCNI CTCAG 6 cut(s) 130, 207, 760, 772, 1402, 1414
BspFNI CGCG 1 cut(s) 1595
BspLI GGNNCC 3 cut(s) 618, 744, 1386
BspMAI CTGCAG 2 cut(s) 1098, 1740
BspOI GCTAGC 1 cut(s) 17
BspPI GGATC 1 cut(s) 656
BspTI CTTAAG 1 cut(s) 157
BspTNI GGTCTC 1 cut(s) 532
BsrFI RCCGGY 2 cut(s) 1040, 1682
BsrI ACTGG 3 cut(s) 265, 996, 1638
BssAI RCCGGY 2 cut(s) 1040, 1682
BssECI CCNNGG 6 cut(s) 816, 916, 1137, 1458, 1558, 1779
BssMI GATC 2 cut(s) 75, 648
BssT1I CCWWGG 3 cut(s) 816, 916, 1458
Bst4CI ACNGT 4 cut(s) 697, 1228, 1339, 1870
Bst6I CTCTTC 2 cut(s) 1172, 1814
BstAFI CTTAAG 1 cut(s) 157
BstAPI GCANNNNNTGC 1 cut(s) 173
BstC8I GCNNGC 4 cut(s) 15, 165, 330, 1306
BstDEI CTNAG 8 cut(s) 117, 194, 747, 780, 827, 1389, 1422, 1469
BstDSI CCRYGG 6 cut(s) 816, 916, 1137, 1458, 1558, 1779
BstENI CCTNNNNNAGG 1 cut(s) 193
BstF5I GGATG 8 cut(s) 550, 571, 1016, 1252, 1293, 1658, 1894, 1935
BstFNI CGCG 1 cut(s) 1595
BstKTI GATC 2 cut(s) 78, 651
BstMAI GTCTC 3 cut(s) 120, 458, 532
BstMBI GATC 2 cut(s) 75, 648
BstMWI GCNNNNNNNGC 3 cut(s) 173, 1046, 1688
BstNSI RCATGY 3 cut(s) 167, 1308, 1950
BstSFI CTRYAG 3 cut(s) 515, 1094, 1736
BstUI CGCG 1 cut(s) 1595
BstV1I GCAGC 1 cut(s) 1982
BsuI GTATCC 1 cut(s) 516
BsuRI GGCC 7 cut(s) 36, 264, 666, 1183, 1194, 1825, 1836
BtgI CCRYGG 6 cut(s) 816, 916, 1137, 1458, 1558, 1779
BtsCI GGATG 8 cut(s) 550, 571, 1016, 1252, 1293, 1658, 1894, 1935
BtsIMutI CAGTG 3 cut(s) 369, 1233, 1875
Cac8I GCNNGC 4 cut(s) 15, 165, 330, 1306
Cfr10I RCCGGY 2 cut(s) 1040, 1682
Cfr13I GGNCC 1 cut(s) 617
Csp6I GTAC 3 cut(s) 429, 1005, 1647
CspCI CAANNNNNGTGG 4 cut(s) 1119, 1154, 1761, 1796
CviQI GTAC 3 cut(s) 429, 1005, 1647
DdeI CTNAG 8 cut(s) 117, 194, 747, 780, 827, 1389, 1422, 1469
DpnI GATC 2 cut(s) 77, 650
DpnII GATC 2 cut(s) 75, 648
EaeI YGGCCR 1 cut(s) 262
Eam1104I CTCTTC 2 cut(s) 1172, 1814
EarI CTCTTC 2 cut(s) 1172, 1814
Eco130I CCWWGG 3 cut(s) 816, 916, 1458
Eco147I AGGCCT 1 cut(s) 36
Eco31I GGTCTC 1 cut(s) 532
Eco32I GATATC 2 cut(s) 924, 1566
Eco47I GGWCC 1 cut(s) 617
EcoNI CCTNNNNNAGG 1 cut(s) 193
EcoO109I RGGNCCY 1 cut(s) 617
EcoRV GATATC 2 cut(s) 924, 1566
EcoT14I CCWWGG 3 cut(s) 816, 916, 1458
ErhI CCWWGG 3 cut(s) 816, 916, 1458
FaqI GGGAC 3 cut(s) 630, 1235, 1877
FauNDI CATATG 1 cut(s) 27
Fnu4HI GCNGC 1 cut(s) 1971
FokI GGATG 8 cut(s) 557, 578, 1003, 1259, 1300, 1645, 1901, 1942
Fsp4HI GCNGC 1 cut(s) 1971
FspBI CTAG 3 cut(s) 14, 425, 432
GluI GCNGC 1 cut(s) 1971
GsaI CCCAGC 2 cut(s) 1287, 1929
HaeIII GGCC 7 cut(s) 36, 264, 666, 1183, 1194, 1825, 1836
HapII CCGG 3 cut(s) 542, 1041, 1683
HincII GTYRAC 4 cut(s) 862, 879, 1504, 1521
HindII GTYRAC 4 cut(s) 862, 879, 1504, 1521
HindIII AAGCTT 1 cut(s) 373
HpaII CCGG 3 cut(s) 542, 1041, 1683
HphI GGTGA 6 cut(s) 236, 598, 835, 862, 1477, 1504
Hpy188I TCNGA 8 cut(s) 130, 231, 292, 460, 797, 910, 1439, 1552
Hpy188III TCNNGA 5 cut(s) 79, 196, 656, 1124, 1766
HpyAV CCTTC 4 cut(s) 257, 324, 877, 1519
HpyCH4III ACNGT 4 cut(s) 697, 1228, 1339, 1870
HpyCH4IV ACGT 1 cut(s) 359
HpyF10VI GCNNNNNNNGC 3 cut(s) 173, 1046, 1688
HpyF3I CTNAG 8 cut(s) 117, 194, 747, 780, 827, 1389, 1422, 1469
HpySE526I ACGT 1 cut(s) 359
Kzo9I GATC 2 cut(s) 75, 648
LmnI GCTCC 2 cut(s) 818, 1460
Lsp1109I GCAGC 1 cut(s) 1982
LweI GCATC 4 cut(s) 973, 1025, 1615, 1667
MaeI CTAG 3 cut(s) 14, 425, 432
MaeII ACGT 1 cut(s) 359
MaeIII GTNAC 6 cut(s) 87, 503, 806, 841, 1448, 1483
MalI GATC 2 cut(s) 77, 650
MboI GATC 2 cut(s) 75, 648
MboII GAAGA 6 cut(s) 1076, 1079, 1189, 1718, 1721, 1831
MluCI AATT 6 cut(s) 19, 532, 573, 1131, 1773, 1974
MlyI GAGTC 1 cut(s) 155
MmeI TCCRAC 1 cut(s) 483
MseI TTAA 6 cut(s) 158, 386, 612, 1055, 1697, 1977
MslI CAYNNNNRTG 3 cut(s) 71, 338, 1309
MspCI CTTAAG 1 cut(s) 157
MspI CCGG 3 cut(s) 542, 1041, 1683
MvnI CGCG 1 cut(s) 1595
MwoI GCNNNNNNNGC 3 cut(s) 173, 1046, 1688
NcoI CCATGG 3 cut(s) 816, 916, 1458
NdeI CATATG 1 cut(s) 27
NdeII GATC 2 cut(s) 75, 648
NheI GCTAGC 1 cut(s) 13
NlaIV GGNNCC 3 cut(s) 618, 744, 1386
NmuCI GTSAC 4 cut(s) 806, 841, 1448, 1483
NspI RCATGY 3 cut(s) 167, 1308, 1950
OliI CACNNNNGTG 1 cut(s) 338
PaeI GCATGC 2 cut(s) 167, 1308
PceI AGGCCT 1 cut(s) 36
PflMI CCANNNNNTGG 2 cut(s) 1190, 1832
PkrI GCNGC 1 cut(s) 1972
PleI GAGTC 1 cut(s) 154
PpsI GAGTC 1 cut(s) 154
PpuMI RGGWCCY 1 cut(s) 617
Psp5II RGGWCCY 1 cut(s) 617
PspFI CCCAGC 2 cut(s) 1283, 1925
PspN4I GGNNCC 3 cut(s) 618, 744, 1386
PspPI GGNCC 1 cut(s) 617
PspPPI RGGWCCY 1 cut(s) 617
PstI CTGCAG 2 cut(s) 1098, 1740
RsaI GTAC 3 cut(s) 430, 1006, 1648
RsaNI GTAC 3 cut(s) 429, 1005, 1647
RseI CAYNNNNRTG 3 cut(s) 71, 338, 1309
SaqAI TTAA 6 cut(s) 158, 386, 612, 1055, 1697, 1977
SatI GCNGC 1 cut(s) 1971
Sau3AI GATC 2 cut(s) 75, 648
Sau96I GGNCC 1 cut(s) 617
SchI GAGTC 1 cut(s) 155
SfaNI GCATC 4 cut(s) 973, 1025, 1615, 1667
SfcI CTRYAG 3 cut(s) 515, 1094, 1736
SinI GGWCC 1 cut(s) 617
SmiMI CAYNNNNRTG 3 cut(s) 71, 338, 1309
SmlI CTYRAG 1 cut(s) 157
SmoI CTYRAG 1 cut(s) 157
SpeI ACTAGT 1 cut(s) 431
SphI GCATGC 2 cut(s) 167, 1308
Sse9I AATT 6 cut(s) 19, 532, 573, 1131, 1773, 1974
SseBI AGGCCT 1 cut(s) 36
SsiI CCGC 1 cut(s) 1595
SspMI CTAG 3 cut(s) 14, 425, 432
StuI AGGCCT 1 cut(s) 36
StyI CCWWGG 3 cut(s) 816, 916, 1458
TaaI ACNGT 4 cut(s) 697, 1228, 1339, 1870
TaiI ACGT 1 cut(s) 362
TaqI TCGA 5 cut(s) 53, 78, 530, 762, 1404
TasI AATT 6 cut(s) 19, 532, 573, 1131, 1773, 1974
Tru1I TTAA 6 cut(s) 158, 386, 612, 1055, 1697, 1977
Tru9I TTAA 6 cut(s) 158, 386, 612, 1055, 1697, 1977
TscAI CASTG 3 cut(s) 369, 1233, 1875
TseFI GTSAC 4 cut(s) 806, 841, 1448, 1483
TseI GCWGC 1 cut(s) 1970
Tsp45I GTSAC 4 cut(s) 806, 841, 1448, 1483
TspDTI ATGAA 6 cut(s) 91, 306, 411, 561, 1190, 1832
TspGWI ACGGA 3 cut(s) 100, 1126, 1768
TspRI CASTG 3 cut(s) 369, 1233, 1875
Van91I CCANNNNNTGG 2 cut(s) 1190, 1832
Vha464I CTTAAG 1 cut(s) 157
VpaK11BI GGWCC 1 cut(s) 617
XagI CCTNNNNNAGG 1 cut(s) 193
XapI RAATTY 2 cut(s) 19, 532
XceI RCATGY 3 cut(s) 167, 1308, 1950
XcmI CCANNNNNNNNNTGG 2 cut(s) 994, 1636
XspI CTAG 3 cut(s) 14, 425, 432
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.