Rorug05G0480300

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000005
OG0013150
Physical Location & Seq
Forward (+)
66143977 .. 66144237
261 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug05G0480300.1

Sequence Viewer

Length: 261 bp
ATGAGCTATAATGAAACCAGAGTTAGACTTGTATCAGGAGATAACACCACATGCCCTACAGGGTCTGACAAAGGATCACCAAGGAATCATAATTACCCATCAATGGGAGCTAAAGTTAAACCCATGGAATCATTTACTGTTGAGTTTAGTAGAAGGGTTAAAAATGTTGGCCTCGCAAAGTCCACTTACAAGCCAAAATCTTCTCCACATCGAAACTTGATATCAAGGTGGTGCCTGATGTTCTTTCCTTCAAGTCCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.68

Weight (kDa)

10.18

Isoelectric Point (pI)

62.01

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
fn3_6 PF17766 30 - 70 1.7e-06 Fibronectin type-III domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013150)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G55280 AT1G55280
fragaria_vesca FvH4_3g45230
malus_domestica MD03G1007100.v1.1
prunus_persica Prupe.6G006700_v2.0.a1
pyrus_communis pycom03g00720
rosa_chinensis RchiOBHm_Chr5g0082841
rosa_laevigata RLG00000036994
rosa_multiflora Rmu_sc0001381.1_g000013 Rmu_sc0007172.1_g000002
rosa_roxburghii Rroxscaffold_1G00001590
rosa_rugosa Rorug05G0480300
rosa_samantha Rh5AG530600 Rh5AG530700 Rh5BG557600 Rh5CG580600 Rh5DG565900
rosa_wichuraiana Rw5G049800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 231
AclWI GGATC 1 cut(s) 82
AfiI CCNNNNNNNGG 2 cut(s) 103, 104
AgsI TTSAA 1 cut(s) 252
AluBI AGCT 2 cut(s) 6, 110
AluI AGCT 2 cut(s) 6, 110
AlwI GGATC 1 cut(s) 82
AlwNI CAGNNNCTG 1 cut(s) 65
AoxI GGCC 1 cut(s) 169
AsuHPI GGTGA 1 cut(s) 69
BanI GGYRCC 1 cut(s) 231
BccI CCATC 1 cut(s) 106
BfmI CTRYAG 1 cut(s) 57
BmiI GGNNCC 1 cut(s) 233
BsaJI CCNNGG 2 cut(s) 80, 123
BsaXI ACNNNNNCTCC 2 cut(s) 99, 129
Bsc4I CCNNNNNNNGG 2 cut(s) 103, 104
BseDI CCNNGG 2 cut(s) 80, 123
BseLI CCNNNNNNNGG 2 cut(s) 103, 104
BshFI GGCC 1 cut(s) 171
BshNI GGYRCC 1 cut(s) 231
BslI CCNNNNNNNGG 2 cut(s) 103, 104
BsnI GGCC 1 cut(s) 171
Bsp143I GATC 1 cut(s) 74
Bsp19I CCATGG 1 cut(s) 123
BspANI GGCC 1 cut(s) 171
BspLI GGNNCC 1 cut(s) 233
BspPI GGATC 1 cut(s) 82
BspT107I GGYRCC 1 cut(s) 231
BssECI CCNNGG 2 cut(s) 80, 123
BssMI GATC 1 cut(s) 74
BssT1I CCWWGG 2 cut(s) 80, 123
Bst4CI ACNGT 1 cut(s) 139
BstDSI CCRYGG 1 cut(s) 123
BstKTI GATC 1 cut(s) 77
BstMBI GATC 1 cut(s) 74
BstNSI RCATGY 1 cut(s) 54
BstSFI CTRYAG 1 cut(s) 57
BsuRI GGCC 1 cut(s) 171
BtgI CCRYGG 1 cut(s) 123
CaiI CAGNNNCTG 1 cut(s) 65
CviAII CATG 2 cut(s) 51, 124
CviJI RGCY 4 cut(s) 6, 110, 171, 193
CviKI_1 RGCY 4 cut(s) 6, 110, 171, 193
DpnI GATC 1 cut(s) 76
DpnII GATC 1 cut(s) 74
Eco130I CCWWGG 2 cut(s) 80, 123
Eco32I GATATC 1 cut(s) 222
EcoRV GATATC 1 cut(s) 222
EcoT14I CCWWGG 2 cut(s) 80, 123
ErhI CCWWGG 2 cut(s) 80, 123
FaeI CATG 2 cut(s) 54, 127
FaiI YATR 4 cut(s) 9, 52, 90, 125
FatI CATG 2 cut(s) 50, 123
HaeIII GGCC 1 cut(s) 171
Hin1II CATG 2 cut(s) 54, 127
HinfI GANTC 2 cut(s) 85, 128
HphI GGTGA 1 cut(s) 69
Hpy166II GTNNAC 1 cut(s) 183
Hpy188I TCNGA 1 cut(s) 67
Hpy188III TCNNGA 1 cut(s) 36
Hpy8I GTNNAC 1 cut(s) 183
HpyAV CCTTC 2 cut(s) 147, 258
HpyCH4III ACNGT 1 cut(s) 139
Hsp92II CATG 2 cut(s) 54, 127
Kzo9I GATC 1 cut(s) 74
LmnI GCTCC 1 cut(s) 107
LpnPI CCDG 4 cut(s) 21, 31, 45, 248
MalI GATC 1 cut(s) 76
MboI GATC 1 cut(s) 74
MboII GAAGA 1 cut(s) 192
MluCI AATT 1 cut(s) 91
MnlI CCTC 1 cut(s) 182
MseI TTAA 2 cut(s) 117, 159
NcoI CCATGG 1 cut(s) 123
NdeII GATC 1 cut(s) 74
NlaIII CATG 2 cut(s) 54, 127
NlaIV GGNNCC 1 cut(s) 233
NspI RCATGY 1 cut(s) 54
PfeI GAWTC 2 cut(s) 85, 128
PspN4I GGNNCC 1 cut(s) 233
PstNI CAGNNNCTG 1 cut(s) 65
SaqAI TTAA 2 cut(s) 117, 159
Sau3AI GATC 1 cut(s) 74
SetI ASST 3 cut(s) 8, 112, 230
SfcI CTRYAG 1 cut(s) 57
Sse9I AATT 1 cut(s) 91
StyI CCWWGG 2 cut(s) 80, 123
TaaI ACNGT 1 cut(s) 139
TaqI TCGA 1 cut(s) 211
TasI AATT 1 cut(s) 91
TfiI GAWTC 2 cut(s) 85, 128
Tru1I TTAA 2 cut(s) 117, 159
Tru9I TTAA 2 cut(s) 117, 159
TspDTI ATGAA 1 cut(s) 27
XceI RCATGY 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.