Rmu_sc0001516.1_g000068

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001516.1
OG0018091
Physical Location & Seq
Forward (+)
246132 .. 248280
2149 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001516.1_g000068.1.cds

Sequence Viewer

Length: 621 bp
atgtggatgtccagctgtggatggctagcggaggatgtccagctgtggatggctagcgaaggttgtttagccgtggatatccagcggaggtgtagaaagcttatcatggagggatcttggcaaggccgggaagatggcttcccagtaagctcttggcggcttccgactaccacggtatatggagatataatagaggcatctgggaggtcaaaatttctagtcaacatgttgtctaaggtcgctggttatgctagcatagcgttgacactttttactgcaggcattatggtgtgggatctgttttcagctgaggacatctttcaaaaggctactcatgatgctgtggtgactgtagcagcgtttggtggtgccttgctaggagaagttgttggagttacactagcaattactactggggcaactgctggatttgcgttgatggcaggaataataactagctttgcaggagcttatcttattggagaattcgctggttggttgatcgattctatttttgcaggaacttatgacactttaagcacagagggctatcgatgttacgtagtagagctgcctgatgtcaaggctcttgctcgtcaacttgtgcatcagagcaattag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

206

Amino Acids

22.22

Weight (kDa)

4.74

Isoelectric Point (pI)

35.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018091)

Species Orthologous Gene IDs
malus_domestica MD09G1162800.v1.1 MD10G1107800.v1.1 MD17G1147800.v1.1
pyrus_communis pycom09g08030
rosa_laevigata RLG00000019198
rosa_multiflora Rmu_sc0001516.1_g000062 Rmu_sc0001516.1_g000068
rosa_roxburghii Rroxscaffold_1G00006390
rosa_samantha Rh2AG462000 Rh2AG462300 Rh2CG449000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 368
AciI CCGC 3 cut(s) 29, 85, 157
AclWI GGATC 2 cut(s) 121, 303
AcsI RAATTY 2 cut(s) 212, 485
AflIII ACRYGT 1 cut(s) 225
AgsI TTSAA 1 cut(s) 323
AluBI AGCT 8 cut(s) 15, 43, 100, 150, 308, 459, 470, 571
AluI AGCT 8 cut(s) 15, 43, 100, 150, 308, 459, 470, 571
AlwI GGATC 2 cut(s) 121, 303
AoxI GGCC 1 cut(s) 124
ApeKI GCWGC 2 cut(s) 356, 571
ApoI RAATTY 2 cut(s) 212, 485
AsuC2I CCSGG 1 cut(s) 128
AsuHPI GGTGA 1 cut(s) 358
AsuNHI GCTAGC 3 cut(s) 25, 53, 251
BanI GGYRCC 1 cut(s) 368
BbvCI CCTCAGC 1 cut(s) 309
BbvI GCAGC 2 cut(s) 368, 558
BccI CCATC 4 cut(s) 15, 43, 128, 433
BceAI ACGGC 1 cut(s) 56
BcnI CCSGG 1 cut(s) 128
BfaI CTAG 7 cut(s) 26, 54, 218, 252, 377, 401, 456
BfmI CTRYAG 2 cut(s) 276, 351
BisI GCNGC 3 cut(s) 158, 357, 572
BlsI GCNGC 3 cut(s) 159, 358, 573
Bme1390I CCNGG 1 cut(s) 128
BmiI GGNNCC 1 cut(s) 370
BmrFI CCNGG 1 cut(s) 128
BmrI ACTGGG 2 cut(s) 137, 423
BmsI GCATC 3 cut(s) 206, 328, 616
BmtI GCTAGC 3 cut(s) 29, 57, 255
BmuI ACTGGG 2 cut(s) 137, 423
Bpu10I CCTNAGC 1 cut(s) 309
BpuMI CCSGG 1 cut(s) 128
Bsa29I ATCGAT 2 cut(s) 504, 553
BsaAI YACGTR 1 cut(s) 562
BsaJI CCNNGG 2 cut(s) 72, 171
BsaXI ACNNNNNCTCC 2 cut(s) 372, 402
Bse1I ACTGG 2 cut(s) 143, 418
BseCI ATCGAT 2 cut(s) 504, 553
BseDI CCNNGG 2 cut(s) 72, 171
BseGI GGATG 4 cut(s) 12, 26, 40, 54
BseMII CTCAG 1 cut(s) 300
BseNI ACTGG 2 cut(s) 143, 418
BseXI GCAGC 2 cut(s) 368, 558
BshFI GGCC 1 cut(s) 126
BshNI GGYRCC 1 cut(s) 368
BshVI ATCGAT 2 cut(s) 504, 553
BsiSI CCGG 1 cut(s) 127
BsnI GGCC 1 cut(s) 126
Bsp143I GATC 3 cut(s) 113, 295, 501
BspACI CCGC 3 cut(s) 29, 85, 157
BspANI GGCC 1 cut(s) 126
BspCNI CTCAG 1 cut(s) 301
BspDI ATCGAT 2 cut(s) 504, 553
BspHI TCATGA 1 cut(s) 334
BspLI GGNNCC 1 cut(s) 370
BspMAI CTGCAG 1 cut(s) 280
BspOI GCTAGC 3 cut(s) 29, 57, 255
BspPI GGATC 2 cut(s) 121, 303
BspT107I GGYRCC 1 cut(s) 368
BsrI ACTGG 2 cut(s) 143, 418
BssECI CCNNGG 2 cut(s) 72, 171
BssMI GATC 3 cut(s) 113, 295, 501
Bst4CI ACNGT 2 cut(s) 175, 352
BstBAI YACGTR 1 cut(s) 562
BstC8I GCNNGC 4 cut(s) 27, 55, 253, 280
BstDEI CTNAG 2 cut(s) 234, 309
BstDSI CCRYGG 2 cut(s) 72, 171
BstF5I GGATG 4 cut(s) 12, 26, 40, 54
BstKTI GATC 3 cut(s) 116, 298, 504
BstMBI GATC 3 cut(s) 113, 295, 501
BstMWI GCNNNNNNNGC 5 cut(s) 248, 257, 431, 440, 546
BstNSI RCATGY 1 cut(s) 229
BstSCI CCNGG 1 cut(s) 126
BstSFI CTRYAG 2 cut(s) 276, 351
BstSNI TACGTA 1 cut(s) 562
BstV1I GCAGC 2 cut(s) 368, 558
BstX2I RGATCY 2 cut(s) 113, 295
BstYI RGATCY 2 cut(s) 113, 295
Bsu15I ATCGAT 2 cut(s) 504, 553
BsuRI GGCC 1 cut(s) 126
BsuTUI ATCGAT 2 cut(s) 504, 553
BtgI CCRYGG 2 cut(s) 72, 171
BtsCI GGATG 4 cut(s) 12, 26, 40, 54
Cac8I GCNNGC 4 cut(s) 27, 55, 253, 280
CciI TCATGA 1 cut(s) 334
ClaI ATCGAT 2 cut(s) 504, 553
CviAII CATG 3 cut(s) 106, 226, 335
DdeI CTNAG 2 cut(s) 234, 309
DpnI GATC 3 cut(s) 115, 297, 503
DpnII GATC 3 cut(s) 113, 295, 501
Eco105I TACGTA 1 cut(s) 562
Eco32I GATATC 1 cut(s) 79
EcoRI GAATTC 1 cut(s) 485
EcoRV GATATC 1 cut(s) 79
FaeI CATG 3 cut(s) 109, 229, 338
FatI CATG 3 cut(s) 105, 225, 334
Fnu4HI GCNGC 3 cut(s) 158, 357, 572
FokI GGATG 4 cut(s) 19, 33, 47, 61
Fsp4HI GCNGC 3 cut(s) 158, 357, 572
FspBI CTAG 7 cut(s) 26, 54, 218, 252, 377, 401, 456
GluI GCNGC 3 cut(s) 158, 357, 572
HaeIII GGCC 1 cut(s) 126
HapII CCGG 1 cut(s) 127
Hin1II CATG 3 cut(s) 109, 229, 338
HincII GTYRAC 3 cut(s) 223, 264, 599
HindII GTYRAC 3 cut(s) 223, 264, 599
HindIII AAGCTT 1 cut(s) 98
HinfI GANTC 1 cut(s) 506
HpaII CCGG 1 cut(s) 127
HphI GGTGA 1 cut(s) 358
Hpy166II GTNNAC 3 cut(s) 223, 264, 599
Hpy188I TCNGA 2 cut(s) 165, 612
Hpy188III TCNNGA 1 cut(s) 335
Hpy8I GTNNAC 3 cut(s) 223, 264, 599
HpyAV CCTTC 1 cut(s) 53
HpyCH4III ACNGT 2 cut(s) 175, 352
HpyCH4IV ACGT 1 cut(s) 561
HpyCH4V TGCA 4 cut(s) 278, 464, 518, 607
HpyF10VI GCNNNNNNNGC 5 cut(s) 248, 257, 431, 440, 546
HpyF3I CTNAG 2 cut(s) 234, 309
HpySE526I ACGT 1 cut(s) 561
Hsp92II CATG 3 cut(s) 109, 229, 338
Kzo9I GATC 3 cut(s) 113, 295, 501
LmnI GCTCC 1 cut(s) 467
Lsp1109I GCAGC 2 cut(s) 368, 558
LweI GCATC 3 cut(s) 206, 328, 616
MaeI CTAG 7 cut(s) 26, 54, 218, 252, 377, 401, 456
MaeII ACGT 1 cut(s) 561
MaeIII GTNAC 3 cut(s) 346, 394, 557
MalI GATC 3 cut(s) 115, 297, 503
MboI GATC 3 cut(s) 113, 295, 501
MboII GAAGA 1 cut(s) 143
MflI RGATCY 2 cut(s) 113, 295
MluCI AATT 4 cut(s) 212, 405, 485, 616
MmeI TCCRAC 2 cut(s) 188, 370
MnlI CCTC 7 cut(s) 25, 81, 103, 187, 198, 304, 538
MseI TTAA 1 cut(s) 536
MslI CAYNNNNRTG 1 cut(s) 287
MspA1I CMGCKG 4 cut(s) 15, 43, 85, 308
MspI CCGG 1 cut(s) 127
MspR9I CCNGG 1 cut(s) 128
MwoI GCNNNNNNNGC 5 cut(s) 248, 257, 431, 440, 546
NciI CCSGG 1 cut(s) 128
NdeII GATC 3 cut(s) 113, 295, 501
NheI GCTAGC 3 cut(s) 25, 53, 251
NlaIII CATG 3 cut(s) 109, 229, 338
NlaIV GGNNCC 1 cut(s) 370
NmuCI GTSAC 1 cut(s) 346
NspI RCATGY 1 cut(s) 229
PagI TCATGA 1 cut(s) 334
PciI ACATGT 1 cut(s) 225
PfeI GAWTC 1 cut(s) 506
PkrI GCNGC 3 cut(s) 159, 358, 573
Ppu21I YACGTR 1 cut(s) 562
PscI ACATGT 1 cut(s) 225
PspN4I GGNNCC 1 cut(s) 370
PstI CTGCAG 1 cut(s) 280
PsuI RGATCY 2 cut(s) 113, 295
PvuII CAGCTG 3 cut(s) 15, 43, 308
RseI CAYNNNNRTG 1 cut(s) 287
SaqAI TTAA 1 cut(s) 536
SatI GCNGC 3 cut(s) 158, 357, 572
Sau3AI GATC 3 cut(s) 113, 295, 501
ScrFI CCNGG 1 cut(s) 128
SfaNI GCATC 3 cut(s) 206, 328, 616
SfcI CTRYAG 2 cut(s) 276, 351
SmiMI CAYNNNNRTG 1 cut(s) 287
SnaBI TACGTA 1 cut(s) 562
Sse9I AATT 4 cut(s) 212, 405, 485, 616
SsiI CCGC 3 cut(s) 29, 85, 157
SspMI CTAG 7 cut(s) 26, 54, 218, 252, 377, 401, 456
StyD4I CCNGG 1 cut(s) 126
TaaI ACNGT 2 cut(s) 175, 352
TaiI ACGT 1 cut(s) 564
TaqI TCGA 2 cut(s) 504, 553
TasI AATT 4 cut(s) 212, 405, 485, 616
TauI GCSGC 1 cut(s) 160
TfiI GAWTC 1 cut(s) 506
Tru1I TTAA 1 cut(s) 536
Tru9I TTAA 1 cut(s) 536
TseFI GTSAC 1 cut(s) 346
TseI GCWGC 2 cut(s) 356, 571
Tsp45I GTSAC 1 cut(s) 346
XapI RAATTY 2 cut(s) 212, 485
XceI RCATGY 1 cut(s) 229
XcmI CCANNNNNNNNNTGG 1 cut(s) 150
XspI CTAG 7 cut(s) 26, 54, 218, 252, 377, 401, 456
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.