Rmu_sc0001616.1_g000050

prolyl 4-hydroxylase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001616.1
Physical Location & Seq
Reverse (-)
243176 .. 252366
9191 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001616.1_g000050.1.cds

Sequence Viewer

Length: 816 bp
atggctgctgcgatgaagattgtgttcggactccttacgtttgtcactgtcggaatgattataggatctgagtttccagcttcaaggagactgggcagaagtctaaatgatggctatcttaaattccccagaggtgttcctcattggaccaatgacaaagaagcagaaattttacgccttggatatgtcaagccagaagtgataagctggtcacctcgaataattgtgcttcataacttcttgagcacggaggaatgcgactatcttagagctattgcctctcctcgccttgaagtatccactgtagtggacatcaaaacaggaaaggggatcaagagtaaggttcgtaccagctctggtatgttcttgagtcctcaagagaaaaagttcccaatgatacaggcaattgaaaaacgtatttctgtctattctcaagtaccaatagaaaatggggaactgattcaagttttgaggtatgaaaaggaccagtattataaacctcatcatgactacttctctgacacttttaacttgaaacgtggtggtcagcgagtagcaacaattctgatgtatctgagtgacaacgttgagggtggagaaacttattttcctatggctggctcaggtgaatgtagctgtggtggaaaagttgtcaagggtatgtctgtcaagccaactaaaggagatgctgtacttttctggagcatgggtctggatggccaatcagatccaaatagcatgcatgcagggtgtgaggtgctagctggggaaaagtggtcagccacaaaatggatgaggcaaagatctacctcttga

Protein Analysis

271

Amino Acids

30.26

Weight (kDa)

9.14

Isoelectric Point (pI)

43.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014358)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G43080
fragaria_vesca FvH4_4g11880 FvH4_4g11880 FvH4_4g11880
malus_domestica MD04G1030700.v1.1
prunus_persica Prupe.1G180100_v2.0.a1 Prupe.1G180100_v2.0.a1
pyrus_communis pycom04g02600
rosa_chinensis RchiOBHm_Chr4g0409351
rosa_laevigata RLG00000008567
rosa_multiflora Rmu_sc0001616.1_g000050
rosa_roxburghii Rroxscaffold_5G00353870
rosa_rugosa Rorug04G0093100
rosa_samantha Rh4AG155700 Rh4BG154200 Rh4DG148700
rosa_wichuraiana Rw4G012740

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 495
AccB7I CCANNNNNTGG 1 cut(s) 789
AclI AACGTT 1 cut(s) 585
AclWI GGATC 3 cut(s) 73, 338, 722
AcoI YGGCCR 1 cut(s) 718
AcsI RAATTY 2 cut(s) 122, 168
AfaI GTAC 3 cut(s) 349, 438, 693
AfiI CCNNNNNNNGG 3 cut(s) 617, 680, 789
AgsI TTSAA 5 cut(s) 84, 293, 410, 464, 535
AleI CACNNNNGTG 1 cut(s) 305
AluBI AGCT 6 cut(s) 80, 207, 272, 354, 636, 764
AluI AGCT 6 cut(s) 80, 207, 272, 354, 636, 764
Alw21I GWGCWC 1 cut(s) 248
Alw26I GTCTC 1 cut(s) 82
AlwI GGATC 3 cut(s) 73, 338, 722
AoxI GGCC 1 cut(s) 718
ApeKI GCWGC 2 cut(s) 5, 8
ApoI RAATTY 2 cut(s) 122, 168
Asp700I GAANNNNTTC 2 cut(s) 386, 459
AspS9I GGNCC 2 cut(s) 147, 484
AsuHPI GGTGA 2 cut(s) 204, 638
AsuNHI GCTAGC 1 cut(s) 760
AvaII GGWCC 2 cut(s) 147, 484
BalI TGGCCA 1 cut(s) 720
Bbv12I GWGCWC 1 cut(s) 248
BccI CCATC 2 cut(s) 104, 710
BciVI GTATCC 1 cut(s) 307
BcoDI GTCTC 1 cut(s) 82
BfaI CTAG 1 cut(s) 761
BfmI CTRYAG 1 cut(s) 303
BfuI GTATCC 1 cut(s) 307
BglII AGATCT 1 cut(s) 803
BisI GCNGC 2 cut(s) 6, 9
BlsI GCNGC 2 cut(s) 7, 10
Bme18I GGWCC 2 cut(s) 147, 484
BmgT120I GGNCC 2 cut(s) 147, 484
BmrI ACTGGG 1 cut(s) 101
BmsI GCATC 1 cut(s) 676
BmtI GCTAGC 1 cut(s) 764
BmuI ACTGGG 1 cut(s) 101
BpmI CTGGAG 1 cut(s) 721
Bpu10I CCTNAGC 1 cut(s) 622
BpuEI CTTGAG 4 cut(s) 262, 360, 388, 417
BsaBI GATNNNNATC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 178
BsaXI ACNNNNNCTCC 4 cut(s) 675, 694, 705, 724
Bsc4I CCNNNNNNNGG 3 cut(s) 617, 680, 789
Bse1I ACTGG 2 cut(s) 96, 487
Bse8I GATNNNNATC 1 cut(s) 114
BseDI CCNNGG 1 cut(s) 178
BseGI GGATG 2 cut(s) 721, 798
BseJI GATNNNNATC 1 cut(s) 114
BseLI CCNNNNNNNGG 3 cut(s) 617, 680, 789
BseMII CTCAG 3 cut(s) 60, 566, 636
BseNI ACTGG 2 cut(s) 96, 487
BseRI GAGGAG 1 cut(s) 273
BseYI CCCAGC 1 cut(s) 764
BshFI GGCC 1 cut(s) 720
BsiHKAI GWGCWC 1 cut(s) 248
BslI CCNNNNNNNGG 3 cut(s) 617, 680, 789
BsmAI GTCTC 1 cut(s) 82
BsmI GAATGC 1 cut(s) 260
BsnI GGCC 1 cut(s) 720
Bsp1286I GDGCHC 1 cut(s) 248
Bsp143I GATC 4 cut(s) 65, 330, 727, 803
BspANI GGCC 1 cut(s) 720
BspCNI CTCAG 3 cut(s) 61, 567, 635
BspHI TCATGA 1 cut(s) 505
BspOI GCTAGC 1 cut(s) 764
BspPI GGATC 3 cut(s) 73, 338, 722
BsrI ACTGG 2 cut(s) 96, 487
BssECI CCNNGG 1 cut(s) 178
BssMI GATC 4 cut(s) 65, 330, 727, 803
BssT1I CCWWGG 1 cut(s) 178
Bst4CI ACNGT 2 cut(s) 49, 304
BstC8I GCNNGC 4 cut(s) 619, 740, 744, 762
BstDEI CTNAG 4 cut(s) 69, 266, 575, 622
BstEII GGTNACC 1 cut(s) 210
BstF5I GGATG 2 cut(s) 721, 798
BstKTI GATC 4 cut(s) 68, 333, 730, 806
BstMAI GTCTC 1 cut(s) 82
BstMBI GATC 4 cut(s) 65, 330, 727, 803
BstNSI RCATGY 2 cut(s) 742, 746
BstPI GGTNACC 1 cut(s) 210
BstSFI CTRYAG 1 cut(s) 303
BstX2I RGATCY 3 cut(s) 65, 727, 803
BstXI CCANNNNNNTGG 1 cut(s) 307
BstYI RGATCY 3 cut(s) 65, 727, 803
BsuI GTATCC 1 cut(s) 307
BsuRI GGCC 1 cut(s) 720
BtgZI GCGATG 1 cut(s) 26
BtsCI GGATG 2 cut(s) 721, 798
BtsIMutI CAGTG 2 cut(s) 45, 300
Cac8I GCNNGC 4 cut(s) 619, 740, 744, 762
CciI TCATGA 1 cut(s) 505
Cfr13I GGNCC 2 cut(s) 147, 484
Csp6I GTAC 3 cut(s) 348, 437, 692
CviAII CATG 4 cut(s) 506, 706, 739, 743
CviQI GTAC 3 cut(s) 348, 437, 692
DdeI CTNAG 4 cut(s) 69, 266, 575, 622
DpnI GATC 4 cut(s) 67, 332, 729, 805
DpnII GATC 4 cut(s) 65, 330, 727, 803
EaeI YGGCCR 1 cut(s) 718
Eco130I CCWWGG 1 cut(s) 178
Eco47I GGWCC 2 cut(s) 147, 484
Eco91I GGTNACC 1 cut(s) 210
EcoO65I GGTNACC 1 cut(s) 210
EcoT14I CCWWGG 1 cut(s) 178
EcoT22I ATGCAT 1 cut(s) 744
ErhI CCWWGG 1 cut(s) 178
FaeI CATG 4 cut(s) 509, 709, 742, 746
FatI CATG 4 cut(s) 505, 705, 738, 742
Fnu4HI GCNGC 2 cut(s) 6, 9
FokI GGATG 2 cut(s) 728, 805
Fsp4HI GCNGC 2 cut(s) 6, 9
FspBI CTAG 1 cut(s) 761
GluI GCNGC 2 cut(s) 6, 9
GsaI CCCAGC 1 cut(s) 768
GsuI CTGGAG 1 cut(s) 721
HaeIII GGCC 1 cut(s) 720
Hin1II CATG 4 cut(s) 509, 709, 742, 746
HinfI GANTC 3 cut(s) 30, 370, 460
HphI GGTGA 2 cut(s) 204, 638
Hpy166II GTNNAC 1 cut(s) 310
Hpy188I TCNGA 7 cut(s) 29, 53, 70, 520, 567, 576, 727
Hpy188III TCNNGA 8 cut(s) 241, 334, 367, 377, 506, 700, 713, 813
Hpy8I GTNNAC 1 cut(s) 310
HpyCH4III ACNGT 2 cut(s) 49, 304
HpyCH4IV ACGT 4 cut(s) 38, 415, 538, 585
HpyCH4V TGCA 2 cut(s) 742, 746
HpyF3I CTNAG 4 cut(s) 69, 266, 575, 622
HpySE526I ACGT 4 cut(s) 38, 415, 538, 585
Hsp92II CATG 4 cut(s) 509, 709, 742, 746
Kzo9I GATC 4 cut(s) 65, 330, 727, 803
LmnI GCTCC 1 cut(s) 702
LweI GCATC 1 cut(s) 676
MaeI CTAG 1 cut(s) 761
MaeII ACGT 4 cut(s) 38, 415, 538, 585
MaeIII GTNAC 3 cut(s) 43, 210, 578
MalI GATC 4 cut(s) 67, 332, 729, 805
MboI GATC 4 cut(s) 65, 330, 727, 803
MboII GAAGA 1 cut(s) 28
MfeI CAATTG 1 cut(s) 405
MflI RGATCY 3 cut(s) 65, 727, 803
MhlI GDGCHC 1 cut(s) 248
MlsI TGGCCA 1 cut(s) 720
MluCI AATT 5 cut(s) 122, 168, 222, 405, 561
MluNI TGGCCA 1 cut(s) 720
MlyI GAGTC 2 cut(s) 24, 379
MmeI TCCRAC 1 cut(s) 31
Mox20I TGGCCA 1 cut(s) 720
Mph1103I ATGCAT 1 cut(s) 744
MroXI GAANNNNTTC 2 cut(s) 386, 459
MscI TGGCCA 1 cut(s) 720
MseI TTAA 2 cut(s) 120, 528
MslI CAYNNNNRTG 1 cut(s) 305
Msp20I TGGCCA 1 cut(s) 720
MunI CAATTG 1 cut(s) 405
Mva1269I GAATGC 1 cut(s) 260
NdeII GATC 4 cut(s) 65, 330, 727, 803
NheI GCTAGC 1 cut(s) 760
NlaIII CATG 4 cut(s) 509, 709, 742, 746
NmuCI GTSAC 3 cut(s) 43, 210, 578
NsiI ATGCAT 1 cut(s) 744
NspI RCATGY 2 cut(s) 742, 746
OliI CACNNNNGTG 1 cut(s) 305
PaeI GCATGC 2 cut(s) 742, 746
PagI TCATGA 1 cut(s) 505
PctI GAATGC 1 cut(s) 260
PdmI GAANNNNTTC 2 cut(s) 386, 459
PfeI GAWTC 1 cut(s) 460
PflMI CCANNNNNTGG 1 cut(s) 789
PkrI GCNGC 2 cut(s) 7, 10
PleI GAGTC 2 cut(s) 24, 378
PpsI GAGTC 2 cut(s) 24, 378
PsiI TTATAA 1 cut(s) 495
Psp1406I AACGTT 1 cut(s) 585
PspEI GGTNACC 1 cut(s) 210
PspFI CCCAGC 1 cut(s) 764
PspPI GGNCC 2 cut(s) 147, 484
PsuI RGATCY 3 cut(s) 65, 727, 803
RsaI GTAC 3 cut(s) 349, 438, 693
RsaNI GTAC 3 cut(s) 348, 437, 692
RseI CAYNNNNRTG 1 cut(s) 305
SaqAI TTAA 2 cut(s) 120, 528
SatI GCNGC 2 cut(s) 6, 9
Sau3AI GATC 4 cut(s) 65, 330, 727, 803
Sau96I GGNCC 2 cut(s) 147, 484
SchI GAGTC 2 cut(s) 24, 379
SduI GDGCHC 1 cut(s) 248
SfaNI GCATC 1 cut(s) 676
SfcI CTRYAG 1 cut(s) 303
SinI GGWCC 2 cut(s) 147, 484
SmiMI CAYNNNNRTG 1 cut(s) 305
SmlI CTYRAG 4 cut(s) 241, 367, 375, 432
SmoI CTYRAG 4 cut(s) 241, 367, 375, 432
SphI GCATGC 2 cut(s) 742, 746
Sse9I AATT 5 cut(s) 122, 168, 222, 405, 561
SspMI CTAG 1 cut(s) 761
StyI CCWWGG 1 cut(s) 178
TaaI ACNGT 2 cut(s) 49, 304
TaiI ACGT 4 cut(s) 41, 418, 541, 588
TaqI TCGA 1 cut(s) 217
TasI AATT 5 cut(s) 122, 168, 222, 405, 561
TatI WGTACW 1 cut(s) 691
TfiI GAWTC 1 cut(s) 460
Tru1I TTAA 2 cut(s) 120, 528
Tru9I TTAA 2 cut(s) 120, 528
TscAI CASTG 2 cut(s) 52, 307
TseFI GTSAC 3 cut(s) 43, 210, 578
TseI GCWGC 2 cut(s) 5, 8
Tsp45I GTSAC 3 cut(s) 43, 210, 578
TspDTI ATGAA 3 cut(s) 29, 221, 492
TspGWI ACGGA 1 cut(s) 263
TspRI CASTG 2 cut(s) 52, 307
Van91I CCANNNNNTGG 1 cut(s) 789
VpaK11BI GGWCC 2 cut(s) 147, 484
XapI RAATTY 2 cut(s) 122, 168
XceI RCATGY 2 cut(s) 742, 746
XmnI GAANNNNTTC 2 cut(s) 386, 459
XspI CTAG 1 cut(s) 761
Zsp2I ATGCAT 1 cut(s) 744
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.