Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001626.1

Orthogroup ID

OG0014685

Physical Location & Seq

Genomic Coordinates Reverse (-)

16691 .. 17201

Gene Structure 511 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001626.1_g000004.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 318 bp

atggcgaaaatcgcaagagtccttctgcagtcactgcttaaagcaatgaattcgattttgggactgcttggaattgcattgattctctatggtctttggatggttagagtttgggagagggacatggatagctcatcatcctttgatcaatatactactgctccatgggttatctgcacttttattggggctggtgttaccttgtgcataataacaggcataggtcatcttgctgcaaactgtggcagtggttgttgcctctcttgtgtatcctttttcatattgtgtgcctatactatacctacaatttgtgtttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Tetraspannin

Protein Analysis

105

Amino Acids

11.3

Weight (kDa)

7.51

Isoelectric Point (pI)

36.08

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014685)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g04940 FvH4_3g04940
malus_domestica	MD05G1314500.v1.1 MD10G1295800.v1.1
prunus_persica	Prupe.4G044700_v2.0.a1
pyrus_communis	pycom05g29240 pycom10g24840
rosa_chinensis	RchiOBHm_Chr5g0008101
rosa_laevigata	RLG00000031536
rosa_multiflora	Rmu_co8286709.1_g000001 Rmu_sc0001626.1_g000004 Rmu_sc0022023.1_g000001
rosa_roxburghii	Rroxscaffold_1G00068380
rosa_samantha	Rh5AG061500 Rh5CG068400 Rh5DG057400
rosa_wichuraiana	Rw5G005910

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	49
AjuI	GAANNNNNNNTTGG	2 cut(s)	41, 73
AluBI	AGCT	1 cut(s)	132
AluI	AGCT	1 cut(s)	132
AlwNI	CAGNNNCTG	1 cut(s)	34
ApeKI	GCWGC	1 cut(s)	233
ApoI	RAATTY	1 cut(s)	49
BbvI	GCAGC	1 cut(s)	220
BccI	CCATC	1 cut(s)	94
BcgI	CGANNNNNNTGC	2 cut(s)	33, 67
BciVI	GTATCC	1 cut(s)	280
BclI	TGATCA	1 cut(s)	145
BfmI	CTRYAG	1 cut(s)	26
BfuI	GTATCC	1 cut(s)	280
BisI	GCNGC	1 cut(s)	234
BlsI	GCNGC	1 cut(s)	235
BsaJI	CCNNGG	1 cut(s)	164
BsaXI	ACNNNNNCTCC	2 cut(s)	145, 175
Bse3DI	GCAATG	1 cut(s)	51
BseDI	CCNNGG	1 cut(s)	164
BseGI	GGATG	2 cut(s)	105, 137
BseMI	GCAATG	1 cut(s)	51
BseXI	GCAGC	1 cut(s)	220
BsgI	GTGCAG	1 cut(s)	160
BslFI	GGGAC	2 cut(s)	75, 134
BsmFI	GGGAC	2 cut(s)	75, 134
Bsp143I	GATC	1 cut(s)	145
Bsp19I	CCATGG	1 cut(s)	164
BspMAI	CTGCAG	1 cut(s)	30
BsrDI	GCAATG	1 cut(s)	51
BssECI	CCNNGG	1 cut(s)	164
BssMI	GATC	1 cut(s)	145
BssT1I	CCWWGG	1 cut(s)	164
Bst4CI	ACNGT	1 cut(s)	242
BstAPI	GCANNNNNTGC	1 cut(s)	34
BstDSI	CCRYGG	1 cut(s)	164
BstF5I	GGATG	2 cut(s)	105, 137
BstKTI	GATC	1 cut(s)	148
BstMBI	GATC	1 cut(s)	145
BstMWI	GCNNNNNNNGC	2 cut(s)	11, 34
BstSFI	CTRYAG	1 cut(s)	26
BstV1I	GCAGC	1 cut(s)	220
BsuI	GTATCC	1 cut(s)	280
BtgI	CCRYGG	1 cut(s)	164
BtsCI	GGATG	2 cut(s)	105, 137
BtsI	GCAGTG	2 cut(s)	32, 253
BtsIMutI	CAGTG	2 cut(s)	32, 253
CaiI	CAGNNNCTG	1 cut(s)	34
CviAII	CATG	2 cut(s)	124, 165
CviJI	RGCY	2 cut(s)	132, 191
CviKI_1	RGCY	2 cut(s)	132, 191
DpnI	GATC	1 cut(s)	147
DpnII	GATC	1 cut(s)	145
Eco130I	CCWWGG	1 cut(s)	164
EcoRI	GAATTC	1 cut(s)	49
EcoT14I	CCWWGG	1 cut(s)	164
ErhI	CCWWGG	1 cut(s)	164
FaeI	CATG	2 cut(s)	127, 168
FaiI	YATR	9 cut(s)	90, 125, 153, 166, 209, 221, 281, 294, 299
FaqI	GGGAC	2 cut(s)	75, 134
FatI	CATG	2 cut(s)	123, 164
FbaI	TGATCA	1 cut(s)	145
Fnu4HI	GCNGC	1 cut(s)	234
FokI	GGATG	2 cut(s)	112, 124
Fsp4HI	GCNGC	1 cut(s)	234
GluI	GCNGC	1 cut(s)	234
Hin1II	CATG	2 cut(s)	127, 168
HinfI	GANTC	2 cut(s)	18, 82
HpyAV	CCTTC	1 cut(s)	32
HpyCH4III	ACNGT	1 cut(s)	242
HpyCH4V	TGCA	5 cut(s)	28, 77, 177, 207, 236
HpyF10VI	GCNNNNNNNGC	2 cut(s)	11, 34
Hsp92II	CATG	2 cut(s)	127, 168
Ksp22I	TGATCA	1 cut(s)	145
Kzo9I	GATC	1 cut(s)	145
LmnI	GCTCC	1 cut(s)	166
LpnPI	CCDG	2 cut(s)	177, 201
Lsp1109I	GCAGC	1 cut(s)	220
MaeIII	GTNAC	2 cut(s)	30, 196
MalI	GATC	1 cut(s)	147
MboI	GATC	1 cut(s)	145
MluCI	AATT	3 cut(s)	49, 72, 306
MlyI	GAGTC	1 cut(s)	27
MnlI	CCTC	2 cut(s)	111, 269
MseI	TTAA	2 cut(s)	39, 316
MwoI	GCNNNNNNNGC	2 cut(s)	11, 34
NcoI	CCATGG	1 cut(s)	164
NdeII	GATC	1 cut(s)	145
NlaIII	CATG	2 cut(s)	127, 168
NmuCI	GTSAC	1 cut(s)	30
PfeI	GAWTC	1 cut(s)	82
PkrI	GCNGC	1 cut(s)	235
PleI	GAGTC	1 cut(s)	26
PpsI	GAGTC	1 cut(s)	26
PstI	CTGCAG	1 cut(s)	30
PstNI	CAGNNNCTG	1 cut(s)	34
SaqAI	TTAA	2 cut(s)	39, 316
SatI	GCNGC	1 cut(s)	234
Sau3AI	GATC	1 cut(s)	145
SchI	GAGTC	1 cut(s)	27
SetI	ASST	4 cut(s)	134, 203, 226, 304
SfcI	CTRYAG	1 cut(s)	26
SgeI	CNNG	9 cut(s)	27, 80, 136, 177, 204, 214, 228, 242, 276
Sse9I	AATT	3 cut(s)	49, 72, 306
StyI	CCWWGG	1 cut(s)	164
TaaI	ACNGT	1 cut(s)	242
TaqI	TCGA	1 cut(s)	53
TasI	AATT	3 cut(s)	49, 72, 306
TfiI	GAWTC	1 cut(s)	82
Tru1I	TTAA	2 cut(s)	39, 316
Tru9I	TTAA	2 cut(s)	39, 316
TscAI	CASTG	2 cut(s)	39, 253
TseFI	GTSAC	1 cut(s)	30
TseI	GCWGC	1 cut(s)	233
Tsp45I	GTSAC	1 cut(s)	30
TspDTI	ATGAA	2 cut(s)	62, 268
TspRI	CASTG	2 cut(s)	39, 253
XapI	RAATTY	1 cut(s)	49

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.