Rmu_sc0001753.1_g000032

Metal dependent phosphohydrolases with conserved 'HD' motif.

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001753.1
OG0013001
Physical Location & Seq
Reverse (-)
156945 .. 159085
2141 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001753.1_g000032.1.cds

Sequence Viewer

Length: 690 bp
atggcgagctggaattgggaagagacggtgagaaaggcggaggagttggtcgtaaaatccatgaaaggcaatgacgcatcacatgacccagcccacgtctggagggtcagagacctcgcactctctcttgctcgcgaagaacaagccctctcctccaactccgactccgactccatgcaaattgtagaacttgctgcactcctccatgatataggtgattataagtacttgagagatccttcggaggacaaactcgttgagcactttcttattgactcgggcatagaggagagcaagaaaacaaagattataaagatcatcaatggaatggggtttaaagatgagctggctgggctgacaaatagtgatcttcctctagaatttggggttgtacaagatgctgatcggcttgatgcaattggtgctataggaattgctcgttgctttacttttggaggaagtaggaatagagtgctacatgatcctaacattcagccacgatctgatttatccaaggaaaagtacatgaaaaaagaggagcaaactaccgttaatcattttcatgagaagcttctcaagctaaaggatctgatgaaaacaaaggctggacggaagagagctgagaaaaggcacaagttcatggaggagtttcttgtagagttctatgaagagtgggatgggagagcttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HD

Protein Analysis

229

Amino Acids

26.26

Weight (kDa)

5.81

Isoelectric Point (pI)

37.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013001)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G17330
fragaria_vesca FvH4_4g36970 FvH4_4g36970 FvH4_4g36970
malus_domestica MD13G1004800.v1.1
prunus_persica Prupe.1G347900_v2.0.a1
pyrus_communis pycom13g00420
rosa_chinensis RchiOBHm_Chr4g0446761
rosa_laevigata RLG00000005634
rosa_multiflora Rmu_sc0001753.1_g000032
rosa_roxburghii Rroxscaffold_5G00387080
rosa_rugosa Rorug04G0374400 Rorug04G0374400
rosa_samantha Rh4AG435800 Rh4BG444700 Rh4CG461900 Rh4DG443600
rosa_wichuraiana Rw4G037250

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 222, 311
AccII CGCG 1 cut(s) 135
AciI CCGC 1 cut(s) 38
AclWI GGATC 3 cut(s) 230, 476, 594
AcsI RAATTY 1 cut(s) 380
AfaI GTAC 3 cut(s) 227, 393, 524
AfiI CCNNNNNNNGG 1 cut(s) 99
AjiI CACGTC 1 cut(s) 97
AluBI AGCT 6 cut(s) 9, 346, 571, 580, 620, 686
AluI AGCT 6 cut(s) 9, 346, 571, 580, 620, 686
Alw21I GWGCWC 1 cut(s) 264
Alw26I GTCTC 2 cut(s) 17, 105
AlwI GGATC 3 cut(s) 230, 476, 594
Ama87I CYCGRG 1 cut(s) 277
ApeKI GCWGC 1 cut(s) 194
ApoI RAATTY 1 cut(s) 380
AsuHPI GGTGA 2 cut(s) 40, 227
AvaI CYCGRG 1 cut(s) 277
Bbv12I GWGCWC 1 cut(s) 264
BbvI GCAGC 1 cut(s) 181
BccI CCATC 1 cut(s) 671
BcoDI GTCTC 2 cut(s) 17, 105
BfaI CTAG 1 cut(s) 377
BfmI CTRYAG 1 cut(s) 426
BisI GCNGC 1 cut(s) 195
BlsI GCNGC 1 cut(s) 196
BmcAI AGTACT 1 cut(s) 227
BmeT110I CYCGRG 1 cut(s) 277
BmgBI CACGTC 1 cut(s) 97
BmsI GCATC 3 cut(s) 86, 388, 403
BpmI CTGGAG 1 cut(s) 121
BpuEI CTTGAG 2 cut(s) 250, 560
BsaBI GATNNNNATC 1 cut(s) 402
BsaI GGTCTC 1 cut(s) 105
BsaJI CCNNGG 1 cut(s) 513
BsaXI ACNNNNNCTCC 4 cut(s) 149, 155, 179, 185
Bsc4I CCNNNNNNNGG 1 cut(s) 99
Bse3DI GCAATG 1 cut(s) 76
Bse8I GATNNNNATC 1 cut(s) 402
BseDI CCNNGG 1 cut(s) 513
BseGI GGATG 1 cut(s) 682
BseJI GATNNNNATC 1 cut(s) 402
BseLI CCNNNNNNNGG 1 cut(s) 99
BseMI GCAATG 1 cut(s) 76
BseMII CTCAG 1 cut(s) 612
BseRI GAGGAG 6 cut(s) 56, 142, 191, 302, 551, 659
BseXI GCAGC 1 cut(s) 181
BseYI CCCAGC 2 cut(s) 88, 350
BsgI GTGCAG 1 cut(s) 180
Bsh1236I CGCG 1 cut(s) 135
BsiHKAI GWGCWC 1 cut(s) 264
BsiHKCI CYCGRG 1 cut(s) 277
BslI CCNNNNNNNGG 1 cut(s) 99
BsmAI GTCTC 2 cut(s) 17, 105
BsmBI CGTCTC 1 cut(s) 17
Bso31I GGTCTC 1 cut(s) 105
BsoBI CYCGRG 1 cut(s) 277
Bsp1286I GDGCHC 1 cut(s) 264
Bsp1407I TGTACA 1 cut(s) 391
Bsp143I GATC 7 cut(s) 235, 315, 367, 403, 481, 500, 586
Bsp68I TCGCGA 1 cut(s) 135
BspACI CCGC 1 cut(s) 38
BspCNI CTCAG 1 cut(s) 613
BspFNI CGCG 1 cut(s) 135
BspHI TCATGA 1 cut(s) 562
BspPI GGATC 3 cut(s) 230, 476, 594
BspTNI GGTCTC 1 cut(s) 105
BsrDI GCAATG 1 cut(s) 76
BsrGI TGTACA 1 cut(s) 391
BssECI CCNNGG 1 cut(s) 513
BssMI GATC 7 cut(s) 235, 315, 367, 403, 481, 500, 586
BssT1I CCWWGG 1 cut(s) 513
Bst4CI ACNGT 2 cut(s) 28, 550
Bst6I CTCTTC 3 cut(s) 15, 608, 663
BstAPI GCANNNNNTGC 1 cut(s) 422
BstAUI TGTACA 1 cut(s) 391
BstC8I GCNNGC 3 cut(s) 7, 133, 348
BstDEI CTNAG 1 cut(s) 621
BstF5I GGATG 1 cut(s) 682
BstFNI CGCG 1 cut(s) 135
BstKTI GATC 7 cut(s) 238, 318, 370, 406, 484, 503, 589
BstMAI GTCTC 2 cut(s) 17, 105
BstMBI GATC 7 cut(s) 235, 315, 367, 403, 481, 500, 586
BstMWI GCNNNNNNNGC 3 cut(s) 352, 422, 577
BstSFI CTRYAG 1 cut(s) 426
BstUI CGCG 1 cut(s) 135
BstV1I GCAGC 1 cut(s) 181
BstX2I RGATCY 2 cut(s) 235, 586
BstYI RGATCY 2 cut(s) 235, 586
BtrI CACGTC 1 cut(s) 97
BtsCI GGATG 1 cut(s) 682
BtuMI TCGCGA 1 cut(s) 135
Cac8I GCNNGC 3 cut(s) 7, 133, 348
CciI TCATGA 1 cut(s) 562
CseI GACGC 1 cut(s) 83
Csp6I GTAC 3 cut(s) 226, 392, 523
CviAII CATG 8 cut(s) 61, 83, 175, 206, 479, 526, 563, 640
CviQI GTAC 3 cut(s) 226, 392, 523
DdeI CTNAG 1 cut(s) 621
DpnI GATC 7 cut(s) 237, 317, 369, 405, 483, 502, 588
DpnII GATC 7 cut(s) 235, 315, 367, 403, 481, 500, 586
DraI TTTAAA 1 cut(s) 337
Eam1104I CTCTTC 3 cut(s) 15, 608, 663
EarI CTCTTC 3 cut(s) 15, 608, 663
EciI GGCGGA 1 cut(s) 53
Eco130I CCWWGG 1 cut(s) 513
Eco31I GGTCTC 1 cut(s) 105
Eco88I CYCGRG 1 cut(s) 277
EcoT14I CCWWGG 1 cut(s) 513
ErhI CCWWGG 1 cut(s) 513
Esp3I CGTCTC 1 cut(s) 17
FaeI CATG 8 cut(s) 64, 86, 178, 209, 482, 529, 566, 643
FatI CATG 8 cut(s) 60, 82, 174, 205, 478, 525, 562, 639
Fnu4HI GCNGC 1 cut(s) 195
Fsp4HI GCNGC 1 cut(s) 195
FspBI CTAG 1 cut(s) 377
GluI GCNGC 1 cut(s) 195
GsaI CCCAGC 2 cut(s) 92, 354
GsuI CTGGAG 1 cut(s) 121
HgaI GACGC 1 cut(s) 83
Hin1II CATG 8 cut(s) 64, 86, 178, 209, 482, 529, 566, 643
HindIII AAGCTT 1 cut(s) 569
HinfI GANTC 3 cut(s) 164, 170, 275
HphI GGTGA 2 cut(s) 40, 227
Hpy188I TCNGA 6 cut(s) 110, 163, 169, 244, 505, 591
Hpy188III TCNNGA 4 cut(s) 100, 134, 377, 563
HpyAV CCTTC 1 cut(s) 249
HpyCH4III ACNGT 2 cut(s) 28, 550
HpyCH4IV ACGT 1 cut(s) 96
HpyCH4V TGCA 3 cut(s) 178, 197, 416
HpyF10VI GCNNNNNNNGC 3 cut(s) 352, 422, 577
HpyF3I CTNAG 1 cut(s) 621
HpySE526I ACGT 1 cut(s) 96
Hsp92II CATG 8 cut(s) 64, 86, 178, 209, 482, 529, 566, 643
Kzo9I GATC 7 cut(s) 235, 315, 367, 403, 481, 500, 586
LmnI GCTCC 1 cut(s) 538
LpnPI CCDG 5 cut(s) 85, 102, 332, 336, 591
Lsp1109I GCAGC 1 cut(s) 181
LweI GCATC 3 cut(s) 86, 388, 403
MaeI CTAG 1 cut(s) 377
MaeII ACGT 1 cut(s) 96
MalI GATC 7 cut(s) 237, 317, 369, 405, 483, 502, 588
MboI GATC 7 cut(s) 235, 315, 367, 403, 481, 500, 586
MboII GAAGA 5 cut(s) 32, 149, 362, 625, 680
MfeI CAATTG 1 cut(s) 417
MflI RGATCY 2 cut(s) 235, 586
MhlI GDGCHC 1 cut(s) 264
MluCI AATT 5 cut(s) 13, 180, 380, 417, 432
MlyI GAGTC 3 cut(s) 158, 164, 269
MmeI TCCRAC 3 cut(s) 180, 186, 192
MseI TTAA 2 cut(s) 336, 552
MslI CAYNNNNRTG 1 cut(s) 561
MunI CAATTG 1 cut(s) 417
MvnI CGCG 1 cut(s) 135
MwoI GCNNNNNNNGC 3 cut(s) 352, 422, 577
NdeII GATC 7 cut(s) 235, 315, 367, 403, 481, 500, 586
NlaIII CATG 8 cut(s) 64, 86, 178, 209, 482, 529, 566, 643
NruI TCGCGA 1 cut(s) 135
PagI TCATGA 1 cut(s) 562
PkrI GCNGC 1 cut(s) 196
PleI GAGTC 3 cut(s) 158, 164, 269
PpsI GAGTC 3 cut(s) 158, 164, 269
PsiI TTATAA 2 cut(s) 222, 311
PspFI CCCAGC 2 cut(s) 88, 350
PsuI RGATCY 2 cut(s) 235, 586
RruI TCGCGA 1 cut(s) 135
RsaI GTAC 3 cut(s) 227, 393, 524
RsaNI GTAC 3 cut(s) 226, 392, 523
RseI CAYNNNNRTG 1 cut(s) 561
SaqAI TTAA 2 cut(s) 336, 552
SatI GCNGC 1 cut(s) 195
Sau3AI GATC 7 cut(s) 235, 315, 367, 403, 481, 500, 586
ScaI AGTACT 1 cut(s) 227
SchI GAGTC 3 cut(s) 158, 164, 269
SduI GDGCHC 1 cut(s) 264
SetI ASST 9 cut(s) 11, 99, 117, 217, 348, 573, 582, 622, 688
SfaNI GCATC 3 cut(s) 86, 388, 403
SfcI CTRYAG 1 cut(s) 426
SmiMI CAYNNNNRTG 1 cut(s) 561
SmlI CTYRAG 2 cut(s) 229, 575
SmoI CTYRAG 2 cut(s) 229, 575
Sse9I AATT 5 cut(s) 13, 180, 380, 417, 432
SsiI CCGC 1 cut(s) 38
SspMI CTAG 1 cut(s) 377
StyI CCWWGG 1 cut(s) 513
TaaI ACNGT 2 cut(s) 28, 550
TaiI ACGT 1 cut(s) 99
TasI AATT 5 cut(s) 13, 180, 380, 417, 432
TatI WGTACW 3 cut(s) 225, 391, 522
Tru1I TTAA 2 cut(s) 336, 552
Tru9I TTAA 2 cut(s) 336, 552
TseI GCWGC 1 cut(s) 194
TspDTI ATGAA 6 cut(s) 77, 542, 551, 608, 628, 681
TspGWI ACGGA 1 cut(s) 625
XapI RAATTY 1 cut(s) 380
XbaI TCTAGA 1 cut(s) 376
XcmI CCANNNNNNNNNTGG 1 cut(s) 96
XspI CTAG 1 cut(s) 377
ZrmI AGTACT 1 cut(s) 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.