Rmu_sc0001759.1_g000008

Meiotic recombination protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001759.1
Physical Location & Seq
Reverse (-)
25062 .. 27623
2562 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001759.1_g000008.1.cds

Sequence Viewer

Length: 957 bp
atggcgtatgatgcaaaatttctacgggtccccgagataatctggcttggagccttccctttggactcggagaagtaccatcttccacaccagtgtctccttcctttgactgcagaagacaagaggaaaactgaagccatgttacagagatgctacttagaaagagaagtgccacagtggagattggagctacagttgatgctggaaagaggcgtgaaatttgagctagaagcattgtctggttttattgagaatcaaagtggtgcatcaatattagcttcgctaagtggttctaaccatgaaggcatcgaaagactgcagtatgaacttagctatcaaatgtggaaccagattcattcagatgattttgttcttttgcagacatgtgttatgaatgcaaatatggattgcgaaaaatgtaggttaaaagtctatgaagtcgtgatcaatgtctatggtgcttattcaatagacatagatgcagaacaatcgatggtaaaagtttcaggcaaagtaaatccaaagataattctacaggtgcttggagggaaacatgccaaggtaaaaagtgtcaagtttgatagtgaggaaccgtccatggggggcggttatccccctccccctccccctcctcttcccccatacggaatggggctggggccccatccctattcctatccgaatggagggccatatgactaccccatgatgatgccaccacttctgatgctgccaccatcaccaccgccaccaccaccaccaccagtggcagcacaacctcaacaaaaaccaacattactattagaggcaccaccccagaattcgggggccacagcacaaccacaaaattcaggaacgtcagcaccaccaaccactaatgttgcagaggaggcagtgataccctcagataagaagtctaagcgttgcggcatcgtcaagaattgcagcattatgtga

Protein Analysis

318

Amino Acids

35.12

Weight (kDa)

5.75

Isoelectric Point (pI)

54.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014977)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 808
AciI CCGC 3 cut(s) 606, 746, 927
AcsI RAATTY 4 cut(s) 17, 218, 820, 847
AcuI CTGAAG 1 cut(s) 153
AfaI GTAC 1 cut(s) 77
AfiI CCNNNNNNNGG 4 cut(s) 599, 644, 686, 823
AflIII ACRYGT 1 cut(s) 383
AgsI TTSAA 1 cut(s) 468
AleI CACNNNNGTG 1 cut(s) 91
AluBI AGCT 4 cut(s) 190, 226, 278, 333
AluI AGCT 4 cut(s) 190, 226, 278, 333
Alw26I GTCTC 1 cut(s) 101
Ama87I CYCGRG 1 cut(s) 32
AoxI GGCC 3 cut(s) 659, 689, 828
ApaI GGGCCC 1 cut(s) 663
ApeKI GCWGC 3 cut(s) 730, 770, 945
ApoI RAATTY 4 cut(s) 17, 218, 820, 847
AspS9I GGNCC 5 cut(s) 28, 659, 660, 689, 828
AsuHPI GGTGA 1 cut(s) 732
AvaI CYCGRG 1 cut(s) 32
AvaII GGWCC 1 cut(s) 28
BaeGI GKGCMC 1 cut(s) 663
BanI GGYRCC 1 cut(s) 808
BanII GRGCYC 1 cut(s) 663
BarI GAAGNNNNNNTAC 2 cut(s) 126, 158
BbsI GAAGAC 1 cut(s) 123
BbvI GCAGC 2 cut(s) 717, 782
BccI CCATC 4 cut(s) 87, 487, 672, 745
BcgI CGANNNNNNTGC 2 cut(s) 471, 505
BclI TGATCA 1 cut(s) 444
BcoDI GTCTC 1 cut(s) 101
BfaI CTAG 1 cut(s) 227
BfmI CTRYAG 4 cut(s) 111, 191, 317, 533
BisI GCNGC 4 cut(s) 731, 771, 928, 946
BlsI GCNGC 4 cut(s) 732, 772, 929, 947
Bme18I GGWCC 1 cut(s) 28
BmeT110I CYCGRG 1 cut(s) 32
BmgT120I GGNCC 5 cut(s) 28, 659, 660, 689, 828
BmsI GCATC 8 cut(s) 140, 189, 275, 315, 469, 702, 717, 939
BpiI GAAGAC 1 cut(s) 123
Bsa29I ATCGAT 1 cut(s) 491
BsaJI CCNNGG 2 cut(s) 558, 597
BsaXI ACNNNNNCTCC 2 cut(s) 179, 209
Bsc4I CCNNNNNNNGG 4 cut(s) 599, 644, 686, 823
Bse1I ACTGG 2 cut(s) 91, 764
BseCI ATCGAT 1 cut(s) 491
BseDI CCNNGG 2 cut(s) 558, 597
BseGI GGATG 1 cut(s) 664
BseLI CCNNNNNNNGG 4 cut(s) 599, 644, 686, 823
BseMII CTCAG 1 cut(s) 918
BseNI ACTGG 2 cut(s) 91, 764
BseRI GAGGAG 2 cut(s) 621, 902
BseSI GKGCMC 1 cut(s) 663
BseXI GCAGC 2 cut(s) 717, 782
BseYI CCCAGC 1 cut(s) 655
BshFI GGCC 3 cut(s) 661, 691, 830
BshNI GGYRCC 1 cut(s) 808
BshVI ATCGAT 1 cut(s) 491
BsiHKCI CYCGRG 1 cut(s) 32
BslFI GGGAC 1 cut(s) 14
BslI CCNNNNNNNGG 4 cut(s) 599, 644, 686, 823
BsmAI GTCTC 1 cut(s) 101
BsmFI GGGAC 1 cut(s) 14
BsmI GAATGC 1 cut(s) 400
BsnI GGCC 3 cut(s) 661, 691, 830
BsoBI CYCGRG 1 cut(s) 32
Bsp120I GGGCCC 1 cut(s) 659
Bsp1286I GDGCHC 1 cut(s) 663
Bsp143I GATC 1 cut(s) 444
Bsp19I CCATGG 1 cut(s) 597
BspACI CCGC 3 cut(s) 606, 746, 927
BspANI GGCC 3 cut(s) 661, 691, 830
BspCNI CTCAG 1 cut(s) 917
BspDI ATCGAT 1 cut(s) 491
BspMAI CTGCAG 2 cut(s) 115, 321
BspT107I GGYRCC 1 cut(s) 808
BsrI ACTGG 2 cut(s) 91, 764
BssECI CCNNGG 2 cut(s) 558, 597
BssMI GATC 1 cut(s) 444
BssT1I CCWWGG 2 cut(s) 558, 597
Bst4CI ACNGT 3 cut(s) 177, 195, 594
Bst6I CTCTTC 1 cut(s) 639
BstDEI CTNAG 5 cut(s) 157, 284, 329, 904, 918
BstDSI CCRYGG 1 cut(s) 597
BstF5I GGATG 1 cut(s) 664
BstKTI GATC 1 cut(s) 447
BstMAI GTCTC 1 cut(s) 101
BstMBI GATC 1 cut(s) 444
BstMWI GCNNNNNNNGC 2 cut(s) 11, 890
BstNSI RCATGY 2 cut(s) 387, 557
BstSFI CTRYAG 4 cut(s) 111, 191, 317, 533
BstSLI GKGCMC 1 cut(s) 663
BstV1I GCAGC 2 cut(s) 717, 782
BstV2I GAAGAC 1 cut(s) 123
Bsu15I ATCGAT 1 cut(s) 491
BsuRI GGCC 3 cut(s) 661, 691, 830
BsuTUI ATCGAT 1 cut(s) 491
BtgI CCRYGG 1 cut(s) 597
BtsCI GGATG 1 cut(s) 664
BtsI GCAGTG 1 cut(s) 900
BtsIMutI CAGTG 4 cut(s) 98, 182, 771, 900
Cfr13I GGNCC 5 cut(s) 28, 659, 660, 689, 828
ClaI ATCGAT 1 cut(s) 491
Csp6I GTAC 1 cut(s) 76
CspCI CAANNNNNGTGG 2 cut(s) 862, 897
CviAII CATG 6 cut(s) 139, 299, 384, 554, 598, 706
CviQI GTAC 1 cut(s) 76
DdeI CTNAG 5 cut(s) 157, 284, 329, 904, 918
DpnI GATC 1 cut(s) 446
DpnII GATC 1 cut(s) 444
Eam1104I CTCTTC 1 cut(s) 639
EarI CTCTTC 1 cut(s) 639
Eco130I CCWWGG 2 cut(s) 558, 597
Eco24I GRGCYC 1 cut(s) 663
Eco47I GGWCC 1 cut(s) 28
Eco57I CTGAAG 1 cut(s) 153
Eco88I CYCGRG 1 cut(s) 32
EcoO109I RGGNCCY 3 cut(s) 28, 659, 660
EcoRI GAATTC 1 cut(s) 820
EcoT14I CCWWGG 2 cut(s) 558, 597
EcoT38I GRGCYC 1 cut(s) 663
ErhI CCWWGG 2 cut(s) 558, 597
FaeI CATG 6 cut(s) 142, 302, 387, 557, 601, 709
FaqI GGGAC 1 cut(s) 14
FatI CATG 6 cut(s) 138, 298, 383, 553, 597, 705
FauNDI CATATG 1 cut(s) 694
FbaI TGATCA 1 cut(s) 444
Fnu4HI GCNGC 4 cut(s) 731, 771, 928, 946
FokI GGATG 1 cut(s) 651
FriOI GRGCYC 1 cut(s) 663
Fsp4HI GCNGC 4 cut(s) 731, 771, 928, 946
FspBI CTAG 1 cut(s) 227
GluI GCNGC 4 cut(s) 731, 771, 928, 946
GsaI CCCAGC 1 cut(s) 659
HaeIII GGCC 3 cut(s) 661, 691, 830
Hin1II CATG 6 cut(s) 142, 302, 387, 557, 601, 709
HinfI GANTC 3 cut(s) 65, 253, 352
HphI GGTGA 1 cut(s) 732
Hpy188I TCNGA 5 cut(s) 70, 361, 681, 726, 907
Hpy188III TCNNGA 3 cut(s) 442, 852, 937
HpyAV CCTTC 3 cut(s) 64, 110, 296
HpyCH4III ACNGT 3 cut(s) 177, 195, 594
HpyCH4IV ACGT 1 cut(s) 857
HpyCH4V TGCA 9 cut(s) 14, 113, 266, 319, 379, 398, 482, 884, 945
HpyF10VI GCNNNNNNNGC 2 cut(s) 11, 890
HpyF3I CTNAG 5 cut(s) 157, 284, 329, 904, 918
HpySE526I ACGT 1 cut(s) 857
Hsp92II CATG 6 cut(s) 142, 302, 387, 557, 601, 709
KflI GGGWCCC 1 cut(s) 28
Ksp22I TGATCA 1 cut(s) 444
Kzo9I GATC 1 cut(s) 444
LmnI GCTCC 2 cut(s) 50, 187
Lsp1109I GCAGC 2 cut(s) 717, 782
LweI GCATC 8 cut(s) 140, 189, 275, 315, 469, 702, 717, 939
MaeI CTAG 1 cut(s) 227
MaeII ACGT 1 cut(s) 857
MaeIII GTNAC 1 cut(s) 141
MalI GATC 1 cut(s) 446
MboI GATC 1 cut(s) 444
MboII GAAGA 3 cut(s) 74, 128, 626
MhlI GDGCHC 1 cut(s) 663
MluCI AATT 6 cut(s) 17, 218, 528, 820, 847, 940
MlyI GAGTC 1 cut(s) 59
MseI TTAA 1 cut(s) 425
MslI CAYNNNNRTG 3 cut(s) 91, 360, 710
Mva1269I GAATGC 1 cut(s) 400
MwoI GCNNNNNNNGC 2 cut(s) 11, 890
NcoI CCATGG 1 cut(s) 597
NdeI CATATG 1 cut(s) 694
NdeII GATC 1 cut(s) 444
NlaIII CATG 6 cut(s) 142, 302, 387, 557, 601, 709
NspI RCATGY 2 cut(s) 387, 557
OliI CACNNNNGTG 1 cut(s) 91
PciI ACATGT 1 cut(s) 383
PctI GAATGC 1 cut(s) 400
PfeI GAWTC 2 cut(s) 253, 352
PkrI GCNGC 4 cut(s) 732, 772, 929, 947
PleI GAGTC 1 cut(s) 59
PpsI GAGTC 1 cut(s) 59
PpuMI RGGWCCY 1 cut(s) 28
PscI ACATGT 1 cut(s) 383
Psp5II RGGWCCY 1 cut(s) 28
PspFI CCCAGC 1 cut(s) 655
PspOMI GGGCCC 1 cut(s) 659
PspPI GGNCC 5 cut(s) 28, 659, 660, 689, 828
PspPPI RGGWCCY 1 cut(s) 28
PstI CTGCAG 2 cut(s) 115, 321
RsaI GTAC 1 cut(s) 77
RsaNI GTAC 1 cut(s) 76
RseI CAYNNNNRTG 3 cut(s) 91, 360, 710
SaqAI TTAA 1 cut(s) 425
SatI GCNGC 4 cut(s) 731, 771, 928, 946
Sau3AI GATC 1 cut(s) 444
Sau96I GGNCC 5 cut(s) 28, 659, 660, 689, 828
SchI GAGTC 1 cut(s) 59
SduI GDGCHC 1 cut(s) 663
SetI ASST 9 cut(s) 192, 228, 280, 335, 425, 540, 564, 781, 860
SfaNI GCATC 8 cut(s) 140, 189, 275, 315, 469, 702, 717, 939
SfcI CTRYAG 4 cut(s) 111, 191, 317, 533
SinI GGWCC 1 cut(s) 28
SmiMI CAYNNNNRTG 3 cut(s) 91, 360, 710
Sse9I AATT 6 cut(s) 17, 218, 528, 820, 847, 940
SsiI CCGC 3 cut(s) 606, 746, 927
SspI AATATT 1 cut(s) 273
SspMI CTAG 1 cut(s) 227
StyI CCWWGG 2 cut(s) 558, 597
TaaI ACNGT 3 cut(s) 177, 195, 594
TaiI ACGT 1 cut(s) 860
TaqI TCGA 2 cut(s) 309, 491
TasI AATT 6 cut(s) 17, 218, 528, 820, 847, 940
TauI GCSGC 1 cut(s) 930
TfiI GAWTC 2 cut(s) 253, 352
Tru1I TTAA 1 cut(s) 425
Tru9I TTAA 1 cut(s) 425
TscAI CASTG 4 cut(s) 98, 182, 771, 900
TseI GCWGC 3 cut(s) 730, 770, 945
TspDTI ATGAA 5 cut(s) 315, 339, 344, 407, 450
TspGWI ACGGA 1 cut(s) 660
TspRI CASTG 4 cut(s) 98, 182, 771, 900
VpaK11BI GGWCC 1 cut(s) 28
XapI RAATTY 4 cut(s) 17, 218, 820, 847
XceI RCATGY 2 cut(s) 387, 557
XspI CTAG 1 cut(s) 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.