Rh5CG390200

transposition, RNA-mediated

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
OG0014977
Physical Location & Seq
Forward (+)
51394258 .. 51396336
2079 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG390200.1

Sequence Viewer

Length: 612 bp
ATGAACTTTCCTTTTTGTCAACCGAGTACATACCATCAAAAATTCAAGACATGTGTTATGAATGCAAATATGGATTGTGAAAAATGTAGGTTAAAAGTCTATGAAGTCGTGATCAATGTCTATGGTGCTTATTCAATAGACATAGATGCAGAACAATCGATGGTAAAAGTTTCAGGCAAAGTAAATCCAAAGATAATTCTACAGTTGCTTGGAGGGAAACATGCCAAGGTAAAAAGTATCAAGTTTGATAGTGAGGAACCGTCCATGGGGGGCGGTTATCCCCCTCCCCCTCCTCCTCTTCCCCCATACGGAATGGGGCTGGCGCCCCATCCCTATTCCTATCTGAATGGAGGGCCATATGACTACCCCATGATGATGCCACCACTTCTGATGCTGCCACCATCACCACCACCATCATCAGTGGCAGCACAACCTCAACAAAAACCAACATTACTATTAGAAGCACCACCCCAGAATTCGGGGGCCACAGCACAACCACAAAATTCAGGAACGTCAGCACCACCAACCACTAATGTTGCAAAGGAGGCAGTGATACCCTCAGATAACAAGTCTAAGCGTTGCGGCATCGTCAAGAATTGCAGCATTATGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HMA

Protein Analysis

203

Amino Acids

21.91

Weight (kDa)

8.82

Isoelectric Point (pI)

49.61

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HMA PF00403 22 - 64 4.2e-06 Heavy-metal-associated domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014977)

Species Orthologous Gene IDs
arabidopsis_thaliana AT3G13140
fragaria_vesca FvH4_3g29421
malus_domestica MD03G1184600.v1.1 MD03G1184800.v1.1 MD11G1201200.v1.1
prunus_persica Prupe.4G241700_v2.0.a1 Prupe.5G052600_v2.0.a1
pyrus_communis pycom11g17370
rosa_chinensis RchiOBHm_Chr5g0053851
rosa_multiflora Rmu_sc0001759.1_g000008
rosa_roxburghii Rroxscaffold_1G00026750
rosa_samantha Rh5AG353500 Rh5BG365100 Rh5CG390200
rosa_wichuraiana Rw0G002130 Rw0G009540

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 322
AciI CCGC 2 cut(s) 273, 582
AcsI RAATTY 3 cut(s) 41, 475, 502
AcyI GRCGYC 1 cut(s) 323
AfaI GTAC 1 cut(s) 28
AfiI CCNNNNNNNGG 3 cut(s) 266, 308, 478
AflIII ACRYGT 1 cut(s) 50
AgsI TTSAA 2 cut(s) 46, 135
AoxI GGCC 2 cut(s) 353, 483
ApeKI GCWGC 3 cut(s) 394, 425, 600
ApoI RAATTY 3 cut(s) 41, 475, 502
AspLEI GCGC 1 cut(s) 325
AspS9I GGNCC 2 cut(s) 353, 483
AsuHPI GGTGA 1 cut(s) 396
BanI GGYRCC 1 cut(s) 322
BbvI GCAGC 2 cut(s) 381, 437
BccI CCATC 5 cut(s) 42, 154, 336, 409, 421
BcgI CGANNNNNNTGC 2 cut(s) 138, 172
BclI TGATCA 1 cut(s) 111
BfmI CTRYAG 1 cut(s) 200
BfoI RGCGCY 1 cut(s) 326
BisI GCNGC 4 cut(s) 395, 426, 583, 601
BlsI GCNGC 4 cut(s) 396, 427, 584, 602
BmgT120I GGNCC 2 cut(s) 353, 483
BmiI GGNNCC 3 cut(s) 258, 324, 484
BmsI GCATC 4 cut(s) 136, 366, 381, 594
Bsa29I ATCGAT 1 cut(s) 158
BsaHI GRCGYC 1 cut(s) 323
BsaJI CCNNGG 2 cut(s) 225, 264
Bsc4I CCNNNNNNNGG 3 cut(s) 266, 308, 478
BseCI ATCGAT 1 cut(s) 158
BseDI CCNNGG 2 cut(s) 225, 264
BseGI GGATG 1 cut(s) 328
BseLI CCNNNNNNNGG 3 cut(s) 266, 308, 478
BseMII CTCAG 1 cut(s) 573
BseRI GAGGAG 2 cut(s) 282, 285
BseXI GCAGC 2 cut(s) 381, 437
BshFI GGCC 2 cut(s) 355, 485
BshNI GGYRCC 1 cut(s) 322
BshVI ATCGAT 1 cut(s) 158
BslI CCNNNNNNNGG 3 cut(s) 266, 308, 478
BsmI GAATGC 1 cut(s) 67
BsnI GGCC 2 cut(s) 355, 485
Bsp143I GATC 1 cut(s) 111
Bsp19I CCATGG 1 cut(s) 264
BspACI CCGC 2 cut(s) 273, 582
BspANI GGCC 2 cut(s) 355, 485
BspCNI CTCAG 1 cut(s) 572
BspDI ATCGAT 1 cut(s) 158
BspLI GGNNCC 3 cut(s) 258, 324, 484
BspT107I GGYRCC 1 cut(s) 322
BssECI CCNNGG 2 cut(s) 225, 264
BssMI GATC 1 cut(s) 111
BssNI GRCGYC 1 cut(s) 323
BssT1I CCWWGG 2 cut(s) 225, 264
Bst4CI ACNGT 2 cut(s) 204, 261
Bst6I CTCTTC 1 cut(s) 303
BstACI GRCGYC 1 cut(s) 323
BstC8I GCNNGC 1 cut(s) 321
BstDEI CTNAG 2 cut(s) 559, 573
BstDSI CCRYGG 1 cut(s) 264
BstF5I GGATG 1 cut(s) 328
BstH2I RGCGCY 1 cut(s) 326
BstHHI GCGC 1 cut(s) 325
BstKTI GATC 1 cut(s) 114
BstMBI GATC 1 cut(s) 111
BstMWI GCNNNNNNNGC 1 cut(s) 545
BstNSI RCATGY 2 cut(s) 54, 224
BstSFI CTRYAG 1 cut(s) 200
BstV1I GCAGC 2 cut(s) 381, 437
Bsu15I ATCGAT 1 cut(s) 158
BsuRI GGCC 2 cut(s) 355, 485
BsuTUI ATCGAT 1 cut(s) 158
BtgI CCRYGG 1 cut(s) 264
BtsCI GGATG 1 cut(s) 328
BtsI GCAGTG 1 cut(s) 555
BtsIMutI CAGTG 2 cut(s) 426, 555
Cac8I GCNNGC 1 cut(s) 321
CfoI GCGC 1 cut(s) 325
Cfr13I GGNCC 2 cut(s) 353, 483
ClaI ATCGAT 1 cut(s) 158
Csp6I GTAC 1 cut(s) 27
CspCI CAANNNNNGTGG 2 cut(s) 517, 552
CviAII CATG 4 cut(s) 51, 221, 265, 370
CviJI RGCY 3 cut(s) 319, 355, 485
CviKI_1 RGCY 3 cut(s) 319, 355, 485
CviQI GTAC 1 cut(s) 27
DdeI CTNAG 2 cut(s) 559, 573
DinI GGCGCC 1 cut(s) 324
DpnI GATC 1 cut(s) 113
DpnII GATC 1 cut(s) 111
Eam1104I CTCTTC 1 cut(s) 303
EarI CTCTTC 1 cut(s) 303
Eco130I CCWWGG 2 cut(s) 225, 264
EcoRI GAATTC 1 cut(s) 475
EcoT14I CCWWGG 2 cut(s) 225, 264
EgeI GGCGCC 1 cut(s) 324
EheI GGCGCC 1 cut(s) 324
ErhI CCWWGG 2 cut(s) 225, 264
FaeI CATG 4 cut(s) 54, 224, 268, 373
FatI CATG 4 cut(s) 50, 220, 264, 369
FauNDI CATATG 1 cut(s) 358
FbaI TGATCA 1 cut(s) 111
Fnu4HI GCNGC 4 cut(s) 395, 426, 583, 601
FokI GGATG 1 cut(s) 315
Fsp4HI GCNGC 4 cut(s) 395, 426, 583, 601
GlaI GCGC 1 cut(s) 324
GluI GCNGC 4 cut(s) 395, 426, 583, 601
HaeII RGCGCY 1 cut(s) 326
HaeIII GGCC 2 cut(s) 355, 485
HhaI GCGC 1 cut(s) 325
Hin1I GRCGYC 1 cut(s) 323
Hin1II CATG 4 cut(s) 54, 224, 268, 373
Hin6I GCGC 1 cut(s) 323
HinP1I GCGC 1 cut(s) 323
HincII GTYRAC 1 cut(s) 20
HindII GTYRAC 1 cut(s) 20
HphI GGTGA 1 cut(s) 396
Hpy166II GTNNAC 1 cut(s) 20
Hpy188I TCNGA 3 cut(s) 345, 390, 562
Hpy188III TCNNGA 4 cut(s) 46, 109, 507, 592
Hpy8I GTNNAC 1 cut(s) 20
HpyCH4III ACNGT 2 cut(s) 204, 261
HpyCH4IV ACGT 1 cut(s) 512
HpyCH4V TGCA 4 cut(s) 65, 149, 539, 600
HpyF10VI GCNNNNNNNGC 1 cut(s) 545
HpyF3I CTNAG 2 cut(s) 559, 573
HpySE526I ACGT 1 cut(s) 512
Hsp92I GRCGYC 1 cut(s) 323
Hsp92II CATG 4 cut(s) 54, 224, 268, 373
HspAI GCGC 1 cut(s) 323
KasI GGCGCC 1 cut(s) 322
Ksp22I TGATCA 1 cut(s) 111
Kzo9I GATC 1 cut(s) 111
LpnPI CCDG 4 cut(s) 159, 305, 485, 492
Lsp1109I GCAGC 2 cut(s) 381, 437
LweI GCATC 4 cut(s) 136, 366, 381, 594
MaeII ACGT 1 cut(s) 512
MalI GATC 1 cut(s) 113
MboI GATC 1 cut(s) 111
MboII GAAGA 1 cut(s) 290
MluCI AATT 5 cut(s) 41, 195, 475, 502, 595
Mly113I GGCGCC 1 cut(s) 323
MseI TTAA 1 cut(s) 92
MslI CAYNNNNRTG 1 cut(s) 374
Mva1269I GAATGC 1 cut(s) 67
MwoI GCNNNNNNNGC 1 cut(s) 545
NarI GGCGCC 1 cut(s) 323
NcoI CCATGG 1 cut(s) 264
NdeI CATATG 1 cut(s) 358
NdeII GATC 1 cut(s) 111
NlaIII CATG 4 cut(s) 54, 224, 268, 373
NlaIV GGNNCC 3 cut(s) 258, 324, 484
NspI RCATGY 2 cut(s) 54, 224
PciI ACATGT 1 cut(s) 50
PctI GAATGC 1 cut(s) 67
PkrI GCNGC 4 cut(s) 396, 427, 584, 602
PluTI GGCGCC 1 cut(s) 326
PscI ACATGT 1 cut(s) 50
PspN4I GGNNCC 3 cut(s) 258, 324, 484
PspPI GGNCC 2 cut(s) 353, 483
RsaI GTAC 1 cut(s) 28
RsaNI GTAC 1 cut(s) 27
RseI CAYNNNNRTG 1 cut(s) 374
SaqAI TTAA 1 cut(s) 92
SatI GCNGC 4 cut(s) 395, 426, 583, 601
Sau3AI GATC 1 cut(s) 111
Sau96I GGNCC 2 cut(s) 353, 483
SetI ASST 4 cut(s) 92, 231, 436, 515
SfaNI GCATC 4 cut(s) 136, 366, 381, 594
SfcI CTRYAG 1 cut(s) 200
SfoI GGCGCC 1 cut(s) 324
SmiMI CAYNNNNRTG 1 cut(s) 374
Sse9I AATT 5 cut(s) 41, 195, 475, 502, 595
SsiI CCGC 2 cut(s) 273, 582
SspDI GGCGCC 1 cut(s) 322
StyI CCWWGG 2 cut(s) 225, 264
TaaI ACNGT 2 cut(s) 204, 261
TaiI ACGT 1 cut(s) 515
TaqI TCGA 1 cut(s) 158
TasI AATT 5 cut(s) 41, 195, 475, 502, 595
TatI WGTACW 1 cut(s) 26
TauI GCSGC 1 cut(s) 585
Tru1I TTAA 1 cut(s) 92
Tru9I TTAA 1 cut(s) 92
TscAI CASTG 2 cut(s) 426, 555
TseI GCWGC 3 cut(s) 394, 425, 600
TspDTI ATGAA 3 cut(s) 17, 74, 117
TspGWI ACGGA 1 cut(s) 324
TspRI CASTG 2 cut(s) 426, 555
XapI RAATTY 3 cut(s) 41, 475, 502
XceI RCATGY 2 cut(s) 54, 224
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.