Rmu_sc0001772.1_g000051

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001772.1
OG0013621
Physical Location & Seq
Forward (+)
215174 .. 215686
513 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001772.1_g000051.1.cds

Sequence Viewer

Length: 426 bp
atgtttgtgttgagcttctttttagatgtcatatttttgatctccaggaacagagaactggttataccctttggtctctttgttgggtgcttggtgaccaacattttgaaagagacattgcagcaagtgcttaccatttccgaggagaatggatttgaaaagcaccttatcggaatcggctacctctttgttgctgttaagttcatctcttatggtctccctataccgtcgcaactgtttcatctcaatgtcacaaatggtgggtcctgcaagttttgtggctctggagagatggtgatgaattataattttcctttttgcttggatgtgaaactgtatcatctgcgctctttacagaaactgatgggatcggatttcgtggttgccaaaaggatcggattggattctaaccgctgccatacctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

141

Amino Acids

15.93

Weight (kDa)

8.31

Isoelectric Point (pI)

38.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 306
AciI CCGC 1 cut(s) 412
AclWI GGATC 2 cut(s) 376, 401
AgsI TTSAA 2 cut(s) 109, 158
AjnI CCWGG 1 cut(s) 44
AluBI AGCT 1 cut(s) 15
AluI AGCT 1 cut(s) 15
Alw26I GTCTC 3 cut(s) 80, 107, 221
AlwI GGATC 2 cut(s) 376, 401
AlwNI CAGNNNCTG 1 cut(s) 361
ApeKI GCWGC 2 cut(s) 121, 414
ArsI GACNNNNNNTTYG 4 cut(s) 88, 120, 248, 280
AspLEI GCGC 1 cut(s) 348
AspS9I GGNCC 1 cut(s) 264
AsuHPI GGTGA 2 cut(s) 106, 307
AvaII GGWCC 1 cut(s) 264
BbvI GCAGC 2 cut(s) 133, 401
BccI CCATC 2 cut(s) 286, 358
BciT130I CCWGG 1 cut(s) 46
BcoDI GTCTC 3 cut(s) 80, 107, 221
BfaI CTAG 1 cut(s) 424
BisI GCNGC 2 cut(s) 122, 415
BlsI GCNGC 2 cut(s) 123, 416
Bme1390I CCNGG 1 cut(s) 46
Bme18I GGWCC 1 cut(s) 264
BmgT120I GGNCC 1 cut(s) 264
BmiI GGNNCC 1 cut(s) 265
BmrFI CCNGG 1 cut(s) 46
BpmI CTGGAG 2 cut(s) 28, 306
BsaI GGTCTC 2 cut(s) 80, 221
BsaJI CCNNGG 1 cut(s) 141
BsaXI ACNNNNNCTCC 2 cut(s) 279, 309
Bse1I ACTGG 1 cut(s) 63
Bse3DI GCAATG 1 cut(s) 116
BseBI CCWGG 1 cut(s) 46
BseDI CCNNGG 1 cut(s) 141
BseGI GGATG 1 cut(s) 331
BseMI GCAATG 1 cut(s) 116
BseNI ACTGG 1 cut(s) 63
BseRI GAGGAG 1 cut(s) 158
BseXI GCAGC 2 cut(s) 133, 401
BsmAI GTCTC 3 cut(s) 80, 107, 221
Bso31I GGTCTC 2 cut(s) 80, 221
Bsp143I GATC 3 cut(s) 39, 368, 393
BspACI CCGC 1 cut(s) 412
BspLI GGNNCC 1 cut(s) 265
BspPI GGATC 2 cut(s) 376, 401
BspTNI GGTCTC 2 cut(s) 80, 221
BsrDI GCAATG 1 cut(s) 116
BsrI ACTGG 1 cut(s) 63
BssECI CCNNGG 1 cut(s) 141
BssMI GATC 3 cut(s) 39, 368, 393
Bst2UI CCWGG 1 cut(s) 46
Bst4CI ACNGT 3 cut(s) 228, 237, 336
BstAPI GCANNNNNTGC 1 cut(s) 127
BstEII GGTNACC 1 cut(s) 94
BstF5I GGATG 1 cut(s) 331
BstHHI GCGC 1 cut(s) 348
BstKTI GATC 3 cut(s) 42, 371, 396
BstMAI GTCTC 3 cut(s) 80, 107, 221
BstMBI GATC 3 cut(s) 39, 368, 393
BstMWI GCNNNNNNNGC 1 cut(s) 127
BstNI CCWGG 1 cut(s) 46
BstPI GGTNACC 1 cut(s) 94
BstSCI CCNGG 1 cut(s) 44
BstV1I GCAGC 2 cut(s) 133, 401
BtsCI GGATG 1 cut(s) 331
CaiI CAGNNNCTG 1 cut(s) 361
CfoI GCGC 1 cut(s) 348
Cfr13I GGNCC 1 cut(s) 264
CspCI CAANNNNNGTGG 2 cut(s) 259, 294
CviJI RGCY 3 cut(s) 15, 180, 282
CviKI_1 RGCY 3 cut(s) 15, 180, 282
DpnI GATC 3 cut(s) 41, 370, 395
DpnII GATC 3 cut(s) 39, 368, 393
Eco31I GGTCTC 2 cut(s) 80, 221
Eco47I GGWCC 1 cut(s) 264
Eco91I GGTNACC 1 cut(s) 94
EcoO109I RGGNCCY 1 cut(s) 264
EcoO65I GGTNACC 1 cut(s) 94
EcoRII CCWGG 1 cut(s) 44
FaiI YATR 6 cut(s) 32, 65, 213, 224, 306, 420
Fnu4HI GCNGC 2 cut(s) 122, 415
FokI GGATG 1 cut(s) 338
Fsp4HI GCNGC 2 cut(s) 122, 415
FspBI CTAG 1 cut(s) 424
GlaI GCGC 1 cut(s) 347
GluI GCNGC 2 cut(s) 122, 415
GsuI CTGGAG 2 cut(s) 28, 306
HhaI GCGC 1 cut(s) 348
Hin6I GCGC 1 cut(s) 346
HinP1I GCGC 1 cut(s) 346
HinfI GANTC 2 cut(s) 174, 404
HphI GGTGA 2 cut(s) 106, 307
Hpy188I TCNGA 4 cut(s) 142, 173, 373, 398
Hpy188III TCNNGA 1 cut(s) 285
Hpy99I CGWCG 1 cut(s) 232
HpyCH4III ACNGT 3 cut(s) 228, 237, 336
HpyCH4V TGCA 2 cut(s) 121, 270
HpyF10VI GCNNNNNNNGC 1 cut(s) 127
HspAI GCGC 1 cut(s) 346
Kzo9I GATC 3 cut(s) 39, 368, 393
LpnPI CCDG 5 cut(s) 31, 44, 58, 270, 280
Lsp1109I GCAGC 2 cut(s) 133, 401
MaeI CTAG 1 cut(s) 424
MaeIII GTNAC 2 cut(s) 94, 250
MalI GATC 3 cut(s) 41, 370, 395
MboI GATC 3 cut(s) 39, 368, 393
MluCI AATT 2 cut(s) 301, 307
MnlI CCTC 2 cut(s) 136, 194
MseI TTAA 1 cut(s) 198
MslI CAYNNNNRTG 1 cut(s) 246
MspA1I CMGCKG 1 cut(s) 414
MspR9I CCNGG 1 cut(s) 46
MvaI CCWGG 1 cut(s) 46
MwoI GCNNNNNNNGC 1 cut(s) 127
NdeII GATC 3 cut(s) 39, 368, 393
NlaIV GGNNCC 1 cut(s) 265
NmuCI GTSAC 2 cut(s) 94, 250
PfeI GAWTC 2 cut(s) 174, 404
PfoI TCCNGGA 1 cut(s) 44
PkrI GCNGC 2 cut(s) 123, 416
PpuMI RGGWCCY 1 cut(s) 264
PsiI TTATAA 1 cut(s) 306
Psp5II RGGWCCY 1 cut(s) 264
Psp6I CCWGG 1 cut(s) 44
PspEI GGTNACC 1 cut(s) 94
PspGI CCWGG 1 cut(s) 44
PspN4I GGNNCC 1 cut(s) 265
PspPI GGNCC 1 cut(s) 264
PspPPI RGGWCCY 1 cut(s) 264
PsrI GAACNNNNNNTAC 2 cut(s) 48, 80
PstNI CAGNNNCTG 1 cut(s) 361
RseI CAYNNNNRTG 1 cut(s) 246
SaqAI TTAA 1 cut(s) 198
SatI GCNGC 2 cut(s) 122, 415
Sau3AI GATC 3 cut(s) 39, 368, 393
Sau96I GGNCC 1 cut(s) 264
ScrFI CCNGG 1 cut(s) 46
SetI ASST 4 cut(s) 17, 168, 186, 425
SinI GGWCC 1 cut(s) 264
SmiMI CAYNNNNRTG 1 cut(s) 246
Sse9I AATT 2 cut(s) 301, 307
SsiI CCGC 1 cut(s) 412
SspMI CTAG 1 cut(s) 424
StyD4I CCNGG 1 cut(s) 44
TaaI ACNGT 3 cut(s) 228, 237, 336
TasI AATT 2 cut(s) 301, 307
TfiI GAWTC 2 cut(s) 174, 404
Tru1I TTAA 1 cut(s) 198
Tru9I TTAA 1 cut(s) 198
TseFI GTSAC 2 cut(s) 94, 250
TseI GCWGC 2 cut(s) 121, 414
Tsp45I GTSAC 2 cut(s) 94, 250
TspDTI ATGAA 3 cut(s) 193, 230, 314
VpaK11BI GGWCC 1 cut(s) 264
XspI CTAG 1 cut(s) 424
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.