Rh6DG137000

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6D
OG0013621
Physical Location & Seq
Forward (+)
19576906 .. 19577609
704 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6DG137000.1

Sequence Viewer

Length: 216 bp
ATGGCCCAATTCGGTGAACCAAATAAGGGTCACAATCTGGGTCTGCAAATCAAGGTTGTGAAGGAGAAGCTTCTGGAGGCCATCCCTGTCCTAGTCAAAGAGCTTTCATGGAAGAGAGCAGCAGACATTGTTCTAAAGCAACTGCTTTTTCTTGGGGAGAAGGCACTTAAAAGTGACGAAGAAGATGATGTTGGTAATAGTACTGATGATTCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.86

Weight (kDa)

5.02

Isoelectric Point (pI)

29.86

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 202
AfiI CCNNNNNNNGG 1 cut(s) 26
AjuI GAANNNNNNNTTGG 2 cut(s) 174, 206
AluBI AGCT 2 cut(s) 70, 103
AluI AGCT 2 cut(s) 70, 103
AoxI GGCC 2 cut(s) 3, 78
ApeKI GCWGC 1 cut(s) 119
AspS9I GGNCC 1 cut(s) 4
AsuHPI GGTGA 1 cut(s) 26
BbvI GCAGC 1 cut(s) 131
BccI CCATC 1 cut(s) 89
BfaI CTAG 1 cut(s) 92
BisI GCNGC 1 cut(s) 120
BlsI GCNGC 1 cut(s) 121
BmcAI AGTACT 1 cut(s) 202
BmgT120I GGNCC 1 cut(s) 4
BpmI CTGGAG 1 cut(s) 95
Bsc4I CCNNNNNNNGG 1 cut(s) 26
BseGI GGATG 1 cut(s) 81
BseLI CCNNNNNNNGG 1 cut(s) 26
BseXI GCAGC 1 cut(s) 131
BshFI GGCC 2 cut(s) 5, 80
BslI CCNNNNNNNGG 1 cut(s) 26
BsnI GGCC 2 cut(s) 5, 80
BspANI GGCC 2 cut(s) 5, 80
Bst6I CTCTTC 1 cut(s) 107
BstF5I GGATG 1 cut(s) 81
BstV1I GCAGC 1 cut(s) 131
BsuRI GGCC 2 cut(s) 5, 80
BtsCI GGATG 1 cut(s) 81
Cfr13I GGNCC 1 cut(s) 4
Csp6I GTAC 1 cut(s) 201
CviAII CATG 1 cut(s) 108
CviJI RGCY 4 cut(s) 5, 70, 80, 103
CviKI_1 RGCY 4 cut(s) 5, 70, 80, 103
CviQI GTAC 1 cut(s) 201
Eam1104I CTCTTC 1 cut(s) 107
EarI CTCTTC 1 cut(s) 107
FaeI CATG 1 cut(s) 111
FaiI YATR 2 cut(s) 109, 214
FatI CATG 1 cut(s) 107
Fnu4HI GCNGC 1 cut(s) 120
FokI GGATG 1 cut(s) 68
Fsp4HI GCNGC 1 cut(s) 120
FspBI CTAG 1 cut(s) 92
GluI GCNGC 1 cut(s) 120
GsuI CTGGAG 1 cut(s) 95
HaeIII GGCC 2 cut(s) 5, 80
Hin1II CATG 1 cut(s) 111
HindIII AAGCTT 1 cut(s) 68
HinfI GANTC 1 cut(s) 209
HphI GGTGA 1 cut(s) 26
Hpy166II GTNNAC 1 cut(s) 17
Hpy188III TCNNGA 1 cut(s) 74
Hpy8I GTNNAC 1 cut(s) 17
HpyAV CCTTC 2 cut(s) 55, 154
HpyCH4V TGCA 1 cut(s) 46
Hsp92II CATG 1 cut(s) 111
LpnPI CCDG 3 cut(s) 23, 59, 99
Lsp1109I GCAGC 1 cut(s) 131
MaeI CTAG 1 cut(s) 92
MaeIII GTNAC 2 cut(s) 29, 173
MboII GAAGA 3 cut(s) 124, 191, 194
MluCI AATT 1 cut(s) 8
MnlI CCTC 1 cut(s) 70
MseI TTAA 1 cut(s) 168
NlaIII CATG 1 cut(s) 111
NmuCI GTSAC 2 cut(s) 29, 173
PfeI GAWTC 1 cut(s) 209
PkrI GCNGC 1 cut(s) 121
PspPI GGNCC 1 cut(s) 4
RsaI GTAC 1 cut(s) 202
RsaNI GTAC 1 cut(s) 201
SaqAI TTAA 1 cut(s) 168
SatI GCNGC 1 cut(s) 120
Sau96I GGNCC 1 cut(s) 4
ScaI AGTACT 1 cut(s) 202
SetI ASST 3 cut(s) 57, 72, 105
SgeI CNNG 7 cut(s) 50, 64, 86, 98, 104, 120, 164
Sse9I AATT 1 cut(s) 8
SspMI CTAG 1 cut(s) 92
TasI AATT 1 cut(s) 8
TatI WGTACW 1 cut(s) 200
TfiI GAWTC 1 cut(s) 209
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TseFI GTSAC 2 cut(s) 29, 173
TseI GCWGC 1 cut(s) 119
Tsp45I GTSAC 2 cut(s) 29, 173
TspDTI ATGAA 2 cut(s) 96, 201
XspI CTAG 1 cut(s) 92
ZrmI AGTACT 1 cut(s) 202
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.