Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0001793.1

Orthogroup ID

OG0008196

Physical Location & Seq

Genomic Coordinates Reverse (-)

95875 .. 98171

Gene Structure 2297 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0001793.1_g000026.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 717 bp

atggtttttgaggcccttgactgtgattacaagaccaatgtgatggggacccttaatatgcttggccttgcgaagcgaattggggctaggtttttaatcactagtaccagtgaggtctatggtgatccactggagcatcctcagaaggagacttactggggaaatgtcaatcctataggtgagaggagctgttatgacgaaggaaagaggacggcagagacactggcaatggattatcatcgaggtgctggtgttgaggttcgtattgctcgaattttcaatacatatgggccacgtatgtgtttggatgatgggcgtgttgtcagcaattttgttgctcaggctatccgcaaacaaccattgactgtgtacggtgatggtaaacaaacacgaagcttccaatatgtctctgatttggtaaatggactggtggcgttgatggaaggcgaacatgtggggcctttcaacctgggaaatcccggggaattcaccatgctagagcttgctgaggttgtgaaagaaacaattgattcaagtgcaacaatagaattcaggccaaatactgctgatgatcctcataagaggaaacctgatattggcaaagcaaaagagctgttgaactgggagccaaaagtatcactgagggagggactgcctctaatggtgagtgatttccagaatcgcattttaaatgaggatgaaggaaaagggaattaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000166 GO:0003674 GO:0003824 GO:0005488 GO:0005975 GO:0005996 GO:0008150 GO:0008152 GO:0016829 GO:0016830 GO:0016831 GO:0019321 GO:0036094 GO:0042732 GO:0043167 GO:0043168 GO:0044238 GO:0044281 GO:0048037 GO:0048040 GO:0050662 GO:0051287 GO:0070403 GO:0071704 GO:0097159 GO:1901265 GO:1901363

KEGG Pathways

Metabolic & Signaling

ko00520 ko01100 map00520 map01100

Pfam Domains

Protein Families

GDP_Man_Dehyd

Protein Analysis

238

Amino Acids

26.61

Weight (kDa)

5.25

Isoelectric Point (pI)

22.18

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008196)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT3G53520 AT3G53520 AT3G53520 AT3G53520
fragaria_vesca	FvH4_6g14640
malus_domestica	MD04G1118200.v1.1 MD12G1133600.v1.1
prunus_persica	Prupe.6G247300_v2.0.a1 Prupe.6G247300_v2.0.a1
pyrus_communis	pycom04g10780 pycom12g12900
rosa_chinensis	RchiOBHm_Chr3g0467761
rosa_laevigata	RLG00000024475
rosa_multiflora	Rmu_sc0001793.1_g000026
rosa_roxburghii	Rroxscaffold_6G00413440
rosa_rugosa	Rorug03G0089700 Rorug03G0089800 Rorug06G0076700
rosa_samantha	Rh3AG138100 Rh3BG159400 Rh3CG159400 Rh3DG159900
rosa_wichuraiana	Rw3G013080

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	349
AclWI	GGATC	2 cut(s)	119, 566
AcsI	RAATTY	3 cut(s)	273, 485, 548
AfaI	GTAC	2 cut(s)	106, 371
AfiI	CCNNNNNNNGG	1 cut(s)	596
AflIII	ACRYGT	1 cut(s)	451
AgsI	TTSAA	4 cut(s)	280, 466, 534, 619
AhlI	ACTAGT	1 cut(s)	101
AjnI	CCWGG	1 cut(s)	468
AleI	CACNNNNGTG	1 cut(s)	298
AluBI	AGCT	4 cut(s)	189, 396, 502, 613
AluI	AGCT	4 cut(s)	189, 396, 502, 613
Alw26I	GTCTC	3 cut(s)	143, 212, 412
AlwI	GGATC	2 cut(s)	119, 566
Ama87I	CYCGRG	1 cut(s)	479
AoxI	GGCC	5 cut(s)	12, 64, 290, 458, 554
ApoI	RAATTY	3 cut(s)	273, 485, 548
AspS9I	GGNCC	4 cut(s)	13, 48, 290, 458
AsuC2I	CCSGG	2 cut(s)	480, 481
AsuHPI	GGTGA	5 cut(s)	134, 191, 386, 481, 676
AvaI	CYCGRG	1 cut(s)	479
AvaII	GGWCC	1 cut(s)	48
BarI	GAAGNNNNNNTAC	2 cut(s)	137, 169
BbvCI	CCTCAGC	1 cut(s)	507
BccI	CCATC	4 cut(s)	37, 305, 371, 433
BceAI	ACGGC	1 cut(s)	228
BciT130I	CCWGG	1 cut(s)	470
BcnI	CCSGG	2 cut(s)	480, 481
BcoDI	GTCTC	3 cut(s)	143, 212, 412
BcuI	ACTAGT	1 cut(s)	101
BfaI	CTAG	3 cut(s)	87, 102, 497
BfmI	CTRYAG	1 cut(s)	174
Bme1390I	CCNGG	3 cut(s)	470, 480, 481
Bme18I	GGWCC	1 cut(s)	48
BmeT110I	CYCGRG	1 cut(s)	479
BmgT120I	GGNCC	4 cut(s)	13, 48, 290, 458
BmiI	GGNNCC	4 cut(s)	49, 50, 459, 627
BmrFI	CCNGG	3 cut(s)	470, 480, 481
BmrI	ACTGGG	2 cut(s)	166, 631
BmsI	GCATC	1 cut(s)	145
BmuI	ACTGGG	2 cut(s)	166, 631
BpmI	CTGGAG	1 cut(s)	152
Bpu10I	CCTNAGC	2 cut(s)	339, 507
BpuMI	CCSGG	2 cut(s)	480, 481
BsaAI	YACGTR	1 cut(s)	296
BsaBI	GATNNNNATC	1 cut(s)	237
BsaJI	CCNNGG	3 cut(s)	469, 479, 480
Bsc4I	CCNNNNNNNGG	1 cut(s)	596
Bse1I	ACTGG	6 cut(s)	108, 135, 161, 228, 432, 626
Bse3DI	GCAATG	1 cut(s)	234
Bse8I	GATNNNNATC	1 cut(s)	237
BseBI	CCWGG	1 cut(s)	470
BseDI	CCNNGG	3 cut(s)	469, 479, 480
BseGI	GGATG	3 cut(s)	136, 313, 703
BseJI	GATNNNNATC	1 cut(s)	237
BseLI	CCNNNNNNNGG	1 cut(s)	596
BseMI	GCAATG	1 cut(s)	234
BseMII	CTCAG	4 cut(s)	155, 353, 498, 632
BseNI	ACTGG	6 cut(s)	108, 135, 161, 228, 432, 626
BseRI	GAGGAG	1 cut(s)	199
BshFI	GGCC	5 cut(s)	14, 66, 292, 460, 556
BsiHKCI	CYCGRG	1 cut(s)	479
BsiSI	CCGG	1 cut(s)	480
BslFI	GGGAC	2 cut(s)	61, 663
BslI	CCNNNNNNNGG	1 cut(s)	596
BsmAI	GTCTC	3 cut(s)	143, 212, 412
BsmFI	GGGAC	2 cut(s)	61, 663
BsnI	GGCC	5 cut(s)	14, 66, 292, 460, 556
BsoBI	CYCGRG	1 cut(s)	479
Bsp143I	GATC	2 cut(s)	124, 571
BspACI	CCGC	1 cut(s)	349
BspANI	GGCC	5 cut(s)	14, 66, 292, 460, 556
BspCNI	CTCAG	4 cut(s)	154, 352, 499, 633
BspLI	GGNNCC	4 cut(s)	49, 50, 459, 627
BspPI	GGATC	2 cut(s)	119, 566
BsrDI	GCAATG	1 cut(s)	234
BsrI	ACTGG	6 cut(s)	108, 135, 161, 228, 432, 626
BssECI	CCNNGG	3 cut(s)	469, 479, 480
BssMI	GATC	2 cut(s)	124, 571
Bst2UI	CCWGG	1 cut(s)	470
Bst4CI	ACNGT	3 cut(s)	23, 367, 374
BstBAI	YACGTR	1 cut(s)	296
BstC8I	GCNNGC	1 cut(s)	504
BstDEI	CTNAG	4 cut(s)	141, 339, 507, 641
BstF5I	GGATG	3 cut(s)	136, 313, 703
BstKTI	GATC	2 cut(s)	127, 574
BstMAI	GTCTC	3 cut(s)	143, 212, 412
BstMBI	GATC	2 cut(s)	124, 571
BstNI	CCWGG	1 cut(s)	470
BstNSI	RCATGY	1 cut(s)	455
BstSCI	CCNGG	3 cut(s)	468, 478, 479
BstSFI	CTRYAG	1 cut(s)	174
BstXI	CCANNNNNNTGG	1 cut(s)	43
BsuRI	GGCC	5 cut(s)	14, 66, 292, 460, 556
BtsCI	GGATG	3 cut(s)	136, 313, 703
BtsIMutI	CAGTG	4 cut(s)	115, 128, 221, 638
Cac8I	GCNNGC	1 cut(s)	504
Cfr13I	GGNCC	4 cut(s)	13, 48, 290, 458
Cfr9I	CCCGGG	1 cut(s)	479
Csp6I	GTAC	2 cut(s)	105, 370
CviAII	CATG	2 cut(s)	452, 493
CviQI	GTAC	2 cut(s)	105, 370
DdeI	CTNAG	4 cut(s)	141, 339, 507, 641
DpnI	GATC	2 cut(s)	126, 573
DpnII	GATC	2 cut(s)	124, 571
DraI	TTTAAA	1 cut(s)	690
Eco47I	GGWCC	1 cut(s)	48
Eco88I	CYCGRG	1 cut(s)	479
EcoO109I	RGGNCCY	3 cut(s)	13, 48, 458
EcoRI	GAATTC	2 cut(s)	485, 548
EcoRII	CCWGG	1 cut(s)	468
FaeI	CATG	2 cut(s)	455, 496
FaqI	GGGAC	2 cut(s)	61, 663
FatI	CATG	2 cut(s)	451, 492
FauNDI	CATATG	1 cut(s)	286
FokI	GGATG	3 cut(s)	123, 320, 710
FspBI	CTAG	3 cut(s)	87, 102, 497
GsuI	CTGGAG	1 cut(s)	152
HaeIII	GGCC	5 cut(s)	14, 66, 292, 460, 556
HapII	CCGG	1 cut(s)	480
Hin1II	CATG	2 cut(s)	455, 496
HindIII	AAGCTT	1 cut(s)	394
HinfI	GANTC	2 cut(s)	530, 679
HpaII	CCGG	1 cut(s)	480
HphI	GGTGA	5 cut(s)	134, 191, 386, 481, 676
Hpy166II	GTNNAC	2 cut(s)	370, 383
Hpy188I	TCNGA	2 cut(s)	144, 412
Hpy188III	TCNNGA	1 cut(s)	676
Hpy8I	GTNNAC	2 cut(s)	370, 383
HpyAV	CCTTC	4 cut(s)	139, 194, 437, 695
HpyCH4III	ACNGT	3 cut(s)	23, 367, 374
HpyCH4IV	ACGT	1 cut(s)	295
HpyCH4V	TGCA	1 cut(s)	539
HpyF3I	CTNAG	4 cut(s)	141, 339, 507, 641
HpySE526I	ACGT	1 cut(s)	295
Hsp92II	CATG	2 cut(s)	455, 496
KflI	GGGWCCC	1 cut(s)	48
Kzo9I	GATC	2 cut(s)	124, 571
LmnI	GCTCC	3 cut(s)	133, 186, 625
LweI	GCATC	1 cut(s)	145
MaeI	CTAG	3 cut(s)	87, 102, 497
MaeII	ACGT	1 cut(s)	295
MalI	GATC	2 cut(s)	126, 573
MboI	GATC	2 cut(s)	124, 571
MfeI	CAATTG	1 cut(s)	525
MluCI	AATT	7 cut(s)	78, 273, 328, 485, 525, 548, 712
MseI	TTAA	4 cut(s)	54, 95, 689, 715
MslI	CAYNNNNRTG	2 cut(s)	243, 298
MspI	CCGG	1 cut(s)	480
MspR9I	CCNGG	3 cut(s)	470, 480, 481
MunI	CAATTG	1 cut(s)	525
MvaI	CCWGG	1 cut(s)	470
NciI	CCSGG	2 cut(s)	480, 481
NdeI	CATATG	1 cut(s)	286
NdeII	GATC	2 cut(s)	124, 571
NlaIII	CATG	2 cut(s)	455, 496
NlaIV	GGNNCC	4 cut(s)	49, 50, 459, 627
NspI	RCATGY	1 cut(s)	455
OliI	CACNNNNGTG	1 cut(s)	298
PciI	ACATGT	1 cut(s)	451
PcsI	WCGNNNNNNNCGW	1 cut(s)	268
PfeI	GAWTC	2 cut(s)	530, 679
Ppu21I	YACGTR	1 cut(s)	296
PpuMI	RGGWCCY	1 cut(s)	48
PscI	ACATGT	1 cut(s)	451
Psp5II	RGGWCCY	1 cut(s)	48
Psp6I	CCWGG	1 cut(s)	468
PspGI	CCWGG	1 cut(s)	468
PspN4I	GGNNCC	4 cut(s)	49, 50, 459, 627
PspPI	GGNCC	4 cut(s)	13, 48, 290, 458
PspPPI	RGGWCCY	1 cut(s)	48
RsaI	GTAC	2 cut(s)	106, 371
RsaNI	GTAC	2 cut(s)	105, 370
RseI	CAYNNNNRTG	2 cut(s)	243, 298
SaqAI	TTAA	4 cut(s)	54, 95, 689, 715
Sau3AI	GATC	2 cut(s)	124, 571
Sau96I	GGNCC	4 cut(s)	13, 48, 290, 458
ScrFI	CCNGG	3 cut(s)	470, 480, 481
SfaNI	GCATC	1 cut(s)	145
SfcI	CTRYAG	1 cut(s)	174
SinI	GGWCC	1 cut(s)	48
SmaI	CCCGGG	1 cut(s)	481
SmiMI	CAYNNNNRTG	2 cut(s)	243, 298
SpeI	ACTAGT	1 cut(s)	101
Sse9I	AATT	7 cut(s)	78, 273, 328, 485, 525, 548, 712
SsiI	CCGC	1 cut(s)	349
SspMI	CTAG	3 cut(s)	87, 102, 497
StyD4I	CCNGG	3 cut(s)	468, 478, 479
TaaI	ACNGT	3 cut(s)	23, 367, 374
TaiI	ACGT	1 cut(s)	298
TaqI	TCGA	2 cut(s)	241, 271
TasI	AATT	7 cut(s)	78, 273, 328, 485, 525, 548, 712
TfiI	GAWTC	2 cut(s)	530, 679
Tru1I	TTAA	4 cut(s)	54, 95, 689, 715
Tru9I	TTAA	4 cut(s)	54, 95, 689, 715
TscAI	CASTG	4 cut(s)	115, 135, 228, 645
TspDTI	ATGAA	1 cut(s)	714
TspMI	CCCGGG	1 cut(s)	479
TspRI	CASTG	4 cut(s)	115, 135, 228, 645
VpaK11BI	GGWCC	1 cut(s)	48
XapI	RAATTY	3 cut(s)	273, 485, 548
XceI	RCATGY	1 cut(s)	455
XmaI	CCCGGG	1 cut(s)	479
XspI	CTAG	3 cut(s)	87, 102, 497

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.