Rmu_sc0001852.1_g000002

Belongs to the 'GDSL' lipolytic enzyme family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001852.1
OG0015376
Physical Location & Seq
Reverse (-)
8551 .. 10599
2049 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001852.1_g000002.1.cds

Sequence Viewer

Length: 1131 bp
atggccataataagatcttatatcactctggcctttgtaggcttgattcttttgcccatcaacaacctgagctttttggcatatgctgctgagagtgaagggctgggagcttcttttatctttggtgattccctggttgattgcggaaacaataactacttgtcgacattgtccaaggcaaatcttcgtcctaatgggatggatttccagccatctggaggaaatcccaccgggcggttcaccaatggtagaaccattggtgatataattggtgaagaattgggacaaccaaactatgcagttccatttttagctcctaacgctacagggaaagcaatattgtatggggtgaattatgcttcaggaggagcagggatcatgaatgcaacaggaagaatatttgtaaatagggtggggatggatatccaaatcgattatttcaacgagacaaggaagcagattgaaaagctattgggtccatcaaaggcaaaagagtacatttcgaaaaggtctattttctcgatcacagttggagcaaatgactttctgaacaattacctactaccagtcctatccattggagcaagaatttctgagaccccagatgcattcattgatgatatgatcactcacttcagggctcaacttactagactttatcaattgggtgctcggaaatttgtgataggaaatgttggaccaataggttgcataccttaccagaagactatcaatcagcttgaccaagaccaatgtgtggagttgcctaataagcttgcgctgcagtacaatggcagattgaaggacttggttgctgagctgaatgataacctccctggatcaacatttgtttatgcaaacgtgtatgatctagtgtcggacctcattaccaactacgaaaaatatggattttcaacagcaagtagagcttgttgtggaaatggtggccaatatgcaggaatagttccatgtggtccaacatcaagtctgtgtactgatcggtccaagcatgtattctgggatccctaccatccaagtgaagctgccaacattatactcgccaaaaaattgcttgatggaaacacaagagttatttctccaatgaatctcaggcaacttcgagaccattaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Lipase_GDSL

Protein Analysis

376

Amino Acids

41.05

Weight (kDa)

7.54

Isoelectric Point (pI)

31.36

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015376)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G23540
fragaria_vesca FvH4_1g14780
malus_domestica MD02G1161000.v1.1 MD15G1275100.v1.1
prunus_persica Prupe.7G142600_v2.0.a1
pyrus_communis pycom02g12710 pycom15g23820
rosa_chinensis RchiOBHm_Chr2g0103741
rosa_laevigata RLG00000017253
rosa_multiflora Rmu_sc0001852.1_g000002
rosa_roxburghii Rroxscaffold_2G00139440
rosa_rugosa Rorug02G0117000
rosa_samantha Rh2AG165800 Rh2BG173100 Rh2CG171800
rosa_wichuraiana Rw2G012990

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 757
AccI GTMKAC 1 cut(s) 164
AciI CCGC 2 cut(s) 144, 235
AclWI GGATC 4 cut(s) 383, 847, 1016, 1029
AcoI YGGCCR 2 cut(s) 3, 946
AcsI RAATTY 2 cut(s) 588, 677
AcuI CTGAAG 2 cut(s) 345, 619
AfaI GTAC 3 cut(s) 497, 788, 994
AfiI CCNNNNNNNGG 3 cut(s) 218, 234, 757
AflIII ACRYGT 1 cut(s) 861
AgsI TTSAA 4 cut(s) 442, 464, 802, 915
AjnI CCWGG 2 cut(s) 132, 835
AjuI GAANNNNNNNTTGG 2 cut(s) 998, 1030
AluBI AGCT 9 cut(s) 72, 110, 314, 469, 739, 775, 820, 929, 1043
AluI AGCT 9 cut(s) 72, 110, 314, 469, 739, 775, 820, 929, 1043
Alw21I GWGCWC 1 cut(s) 673
Alw26I GTCTC 3 cut(s) 440, 590, 1116
AlwI GGATC 4 cut(s) 383, 847, 1016, 1029
AoxI GGCC 3 cut(s) 3, 30, 946
ApeKI GCWGC 3 cut(s) 86, 781, 1043
ApoI RAATTY 2 cut(s) 588, 677
AspLEI GCGC 1 cut(s) 781
AspS9I GGNCC 5 cut(s) 476, 698, 880, 974, 1002
AsuC2I CCSGG 1 cut(s) 232
AsuHPI GGTGA 5 cut(s) 137, 232, 272, 284, 361
AsuII TTCGAA 1 cut(s) 503
AvaII GGWCC 5 cut(s) 476, 698, 880, 974, 1002
BalI TGGCCA 2 cut(s) 5, 948
BamHI GGATCC 1 cut(s) 1021
BanII GRGCYC 1 cut(s) 643
BbsI GAAGAC 1 cut(s) 731
Bbv12I GWGCWC 1 cut(s) 673
BbvI GCAGC 3 cut(s) 73, 768, 1030
BccI CCATC 7 cut(s) 65, 193, 220, 412, 487, 1038, 1070
BciT130I CCWGG 2 cut(s) 134, 837
BclI TGATCA 1 cut(s) 624
BcnI CCSGG 1 cut(s) 232
BcoDI GTCTC 3 cut(s) 440, 590, 1116
BfaI CTAG 2 cut(s) 651, 872
BfmI CTRYAG 2 cut(s) 324, 782
BglII AGATCT 1 cut(s) 14
BisI GCNGC 3 cut(s) 87, 782, 1044
BlpI GCTNAGC 1 cut(s) 816
BlsI GCNGC 3 cut(s) 88, 783, 1045
Bme1390I CCNGG 3 cut(s) 134, 232, 837
Bme18I GGWCC 5 cut(s) 476, 698, 880, 974, 1002
BmgT120I GGNCC 5 cut(s) 476, 698, 880, 974, 1002
BmiI GGNNCC 2 cut(s) 477, 1023
BmrFI CCNGG 3 cut(s) 134, 232, 837
BmsI GCATC 1 cut(s) 595
BpiI GAAGAC 1 cut(s) 731
BpmI CTGGAG 1 cut(s) 237
Bpu10I CCTNAGC 1 cut(s) 68
Bpu1102I GCTNAGC 1 cut(s) 816
Bpu14I TTCGAA 1 cut(s) 503
BpuMI CCSGG 1 cut(s) 232
Bsa29I ATCGAT 1 cut(s) 432
BsaBI GATNNNNATC 1 cut(s) 422
BsaI GGTCTC 2 cut(s) 590, 1116
BsaJI CCNNGG 3 cut(s) 132, 174, 835
Bsc4I CCNNNNNNNGG 3 cut(s) 218, 234, 757
Bse1I ACTGG 1 cut(s) 566
Bse8I GATNNNNATC 1 cut(s) 422
BseBI CCWGG 2 cut(s) 134, 837
BseCI ATCGAT 1 cut(s) 432
BseDI CCNNGG 3 cut(s) 132, 174, 835
BseGI GGATG 3 cut(s) 204, 423, 1030
BseJI GATNNNNATC 1 cut(s) 422
BseLI CCNNNNNNNGG 3 cut(s) 218, 234, 757
BseMII CTCAG 5 cut(s) 59, 81, 585, 807, 1123
BseNI ACTGG 1 cut(s) 566
BseRI GAGGAG 1 cut(s) 381
BseXI GCAGC 3 cut(s) 73, 768, 1030
BseYI CCCAGC 1 cut(s) 103
BshFI GGCC 3 cut(s) 5, 32, 948
BshVI ATCGAT 1 cut(s) 432
BsiHKAI GWGCWC 1 cut(s) 673
BsiSI CCGG 1 cut(s) 231
BslFI GGGAC 1 cut(s) 297
BslI CCNNNNNNNGG 3 cut(s) 218, 234, 757
BsmAI GTCTC 3 cut(s) 440, 590, 1116
BsmFI GGGAC 1 cut(s) 297
BsmI GAATGC 2 cut(s) 388, 608
BsnI GGCC 3 cut(s) 5, 32, 948
Bso31I GGTCTC 2 cut(s) 590, 1116
Bsp119I TTCGAA 1 cut(s) 503
Bsp1286I GDGCHC 2 cut(s) 643, 673
Bsp143I GATC 8 cut(s) 14, 375, 522, 624, 839, 868, 997, 1021
Bsp1720I GCTNAGC 1 cut(s) 816
BspACI CCGC 2 cut(s) 144, 235
BspANI GGCC 3 cut(s) 5, 32, 948
BspCNI CTCAG 5 cut(s) 60, 82, 586, 808, 1122
BspDI ATCGAT 1 cut(s) 432
BspHI TCATGA 1 cut(s) 378
BspLI GGNNCC 2 cut(s) 477, 1023
BspMAI CTGCAG 1 cut(s) 786
BspPI GGATC 4 cut(s) 383, 847, 1016, 1029
BspT104I TTCGAA 1 cut(s) 503
BspTNI GGTCTC 2 cut(s) 590, 1116
BsrI ACTGG 1 cut(s) 566
BssECI CCNNGG 3 cut(s) 132, 174, 835
BssMI GATC 8 cut(s) 14, 375, 522, 624, 839, 868, 997, 1021
BssT1I CCWWGG 1 cut(s) 174
Bst2UI CCWGG 2 cut(s) 134, 837
Bst4CI ACNGT 1 cut(s) 529
BstAPI GCANNNNNTGC 1 cut(s) 86
BstBI TTCGAA 1 cut(s) 503
BstC8I GCNNGC 1 cut(s) 777
BstDEI CTNAG 5 cut(s) 68, 90, 594, 816, 1109
BstF5I GGATG 3 cut(s) 204, 423, 1030
BstHHI GCGC 1 cut(s) 781
BstKTI GATC 8 cut(s) 17, 378, 525, 627, 842, 871, 1000, 1024
BstMAI GTCTC 3 cut(s) 440, 590, 1116
BstMBI GATC 8 cut(s) 14, 375, 522, 624, 839, 868, 997, 1021
BstMWI GCNNNNNNNGC 5 cut(s) 86, 320, 772, 781, 926
BstNI CCWGG 2 cut(s) 134, 837
BstNSI RCATGY 1 cut(s) 1013
BstSCI CCNGG 3 cut(s) 132, 230, 835
BstSFI CTRYAG 2 cut(s) 324, 782
BstV1I GCAGC 3 cut(s) 73, 768, 1030
BstV2I GAAGAC 1 cut(s) 731
BstX2I RGATCY 2 cut(s) 14, 1021
BstXI CCANNNNNNTGG 1 cut(s) 215
BstYI RGATCY 2 cut(s) 14, 1021
Bsu15I ATCGAT 1 cut(s) 432
BsuRI GGCC 3 cut(s) 5, 32, 948
BsuTUI ATCGAT 1 cut(s) 432
BtsCI GGATG 3 cut(s) 204, 423, 1030
Cac8I GCNNGC 1 cut(s) 777
CciI TCATGA 1 cut(s) 378
CfoI GCGC 1 cut(s) 781
Cfr13I GGNCC 5 cut(s) 476, 698, 880, 974, 1002
ClaI ATCGAT 1 cut(s) 432
Csp6I GTAC 3 cut(s) 496, 787, 993
CviAII CATG 3 cut(s) 379, 969, 1010
CviQI GTAC 3 cut(s) 496, 787, 993
DdeI CTNAG 5 cut(s) 68, 90, 594, 816, 1109
DpnI GATC 8 cut(s) 16, 377, 524, 626, 841, 870, 999, 1023
DpnII GATC 8 cut(s) 14, 375, 522, 624, 839, 868, 997, 1021
EaeI YGGCCR 2 cut(s) 3, 946
Eco130I CCWWGG 1 cut(s) 174
Eco24I GRGCYC 1 cut(s) 643
Eco31I GGTCTC 2 cut(s) 590, 1116
Eco32I GATATC 1 cut(s) 424
Eco47I GGWCC 5 cut(s) 476, 698, 880, 974, 1002
Eco57I CTGAAG 2 cut(s) 345, 619
EcoRII CCWGG 2 cut(s) 132, 835
EcoRV GATATC 1 cut(s) 424
EcoT14I CCWWGG 1 cut(s) 174
EcoT22I ATGCAT 1 cut(s) 610
EcoT38I GRGCYC 1 cut(s) 643
ErhI CCWWGG 1 cut(s) 174
FaeI CATG 3 cut(s) 382, 972, 1013
FalI AAGNNNNNCTT 2 cut(s) 913, 945
FaqI GGGAC 1 cut(s) 297
FatI CATG 3 cut(s) 378, 968, 1009
FauNDI CATATG 1 cut(s) 82
FbaI TGATCA 1 cut(s) 624
FblI GTMKAC 1 cut(s) 164
Fnu4HI GCNGC 3 cut(s) 87, 782, 1044
FokI GGATG 3 cut(s) 211, 430, 1017
FriOI GRGCYC 1 cut(s) 643
Fsp4HI GCNGC 3 cut(s) 87, 782, 1044
FspBI CTAG 2 cut(s) 651, 872
GlaI GCGC 1 cut(s) 780
GluI GCNGC 3 cut(s) 87, 782, 1044
GsaI CCCAGC 1 cut(s) 107
GsuI CTGGAG 1 cut(s) 237
HaeIII GGCC 3 cut(s) 5, 32, 948
HapII CCGG 1 cut(s) 231
HhaI GCGC 1 cut(s) 781
Hin1II CATG 3 cut(s) 382, 972, 1013
Hin6I GCGC 1 cut(s) 779
HinP1I GCGC 1 cut(s) 779
HincII GTYRAC 1 cut(s) 165
HindII GTYRAC 1 cut(s) 165
HindIII AAGCTT 1 cut(s) 773
HinfI GANTC 3 cut(s) 46, 128, 1105
HpaII CCGG 1 cut(s) 231
HphI GGTGA 5 cut(s) 137, 232, 272, 284, 361
Hpy166II GTNNAC 3 cut(s) 165, 240, 993
Hpy188I TCNGA 4 cut(s) 549, 595, 675, 880
Hpy188III TCNNGA 5 cut(s) 216, 363, 379, 520, 1121
Hpy8I GTNNAC 3 cut(s) 165, 240, 993
HpyAV CCTTC 2 cut(s) 92, 796
HpyCH4III ACNGT 1 cut(s) 529
HpyCH4IV ACGT 1 cut(s) 861
HpyCH4V TGCA 7 cut(s) 299, 386, 608, 711, 784, 857, 956
HpyF10VI GCNNNNNNNGC 5 cut(s) 86, 320, 772, 781, 926
HpyF3I CTNAG 5 cut(s) 68, 90, 594, 816, 1109
HpySE526I ACGT 1 cut(s) 861
Hsp92II CATG 3 cut(s) 382, 972, 1013
HspAI GCGC 1 cut(s) 779
Ksp22I TGATCA 1 cut(s) 624
Kzo9I GATC 8 cut(s) 14, 375, 522, 624, 839, 868, 997, 1021
LmnI GCTCC 5 cut(s) 107, 319, 368, 533, 581
Lsp1109I GCAGC 3 cut(s) 73, 768, 1030
LweI GCATC 1 cut(s) 595
MaeI CTAG 2 cut(s) 651, 872
MaeII ACGT 1 cut(s) 861
MalI GATC 8 cut(s) 16, 377, 524, 626, 841, 870, 999, 1023
MboI GATC 8 cut(s) 14, 375, 522, 624, 839, 868, 997, 1021
MboII GAAGA 4 cut(s) 176, 287, 405, 736
MfeI CAATTG 1 cut(s) 662
MflI RGATCY 2 cut(s) 14, 1021
MhlI GDGCHC 2 cut(s) 643, 673
MlsI TGGCCA 2 cut(s) 5, 948
MluCI AATT 8 cut(s) 267, 278, 352, 553, 588, 662, 677, 1067
MluNI TGGCCA 2 cut(s) 5, 948
MmeI TCCRAC 4 cut(s) 511, 676, 858, 1001
MnlI CCTC 4 cut(s) 212, 359, 842, 893
Mox20I TGGCCA 2 cut(s) 5, 948
Mph1103I ATGCAT 1 cut(s) 610
MscI TGGCCA 2 cut(s) 5, 948
MseI TTAA 1 cut(s) 1129
MslI CAYNNNNRTG 1 cut(s) 1035
Msp20I TGGCCA 2 cut(s) 5, 948
MspI CCGG 1 cut(s) 231
MspR9I CCNGG 3 cut(s) 134, 232, 837
MunI CAATTG 1 cut(s) 662
Mva1269I GAATGC 2 cut(s) 388, 608
MvaI CCWGG 2 cut(s) 134, 837
MwoI GCNNNNNNNGC 5 cut(s) 86, 320, 772, 781, 926
NciI CCSGG 1 cut(s) 232
NdeI CATATG 1 cut(s) 82
NdeII GATC 8 cut(s) 14, 375, 522, 624, 839, 868, 997, 1021
NlaIII CATG 3 cut(s) 382, 972, 1013
NlaIV GGNNCC 2 cut(s) 477, 1023
NsiI ATGCAT 1 cut(s) 610
NspI RCATGY 1 cut(s) 1013
NspV TTCGAA 1 cut(s) 503
PagI TCATGA 1 cut(s) 378
PctI GAATGC 2 cut(s) 388, 608
PfeI GAWTC 3 cut(s) 46, 128, 1105
PflFI GACNNNGTC 1 cut(s) 169
PflMI CCANNNNNTGG 1 cut(s) 757
PkrI GCNGC 3 cut(s) 88, 783, 1045
Psp6I CCWGG 2 cut(s) 132, 835
PspFI CCCAGC 1 cut(s) 103
PspGI CCWGG 2 cut(s) 132, 835
PspN4I GGNNCC 2 cut(s) 477, 1023
PspPI GGNCC 5 cut(s) 476, 698, 880, 974, 1002
PstI CTGCAG 1 cut(s) 786
PsuI RGATCY 2 cut(s) 14, 1021
PsyI GACNNNGTC 1 cut(s) 169
RsaI GTAC 3 cut(s) 497, 788, 994
RsaNI GTAC 3 cut(s) 496, 787, 993
RseI CAYNNNNRTG 1 cut(s) 1035
SalI GTCGAC 1 cut(s) 163
SaqAI TTAA 1 cut(s) 1129
SatI GCNGC 3 cut(s) 87, 782, 1044
Sau3AI GATC 8 cut(s) 14, 375, 522, 624, 839, 868, 997, 1021
Sau96I GGNCC 5 cut(s) 476, 698, 880, 974, 1002
ScrFI CCNGG 3 cut(s) 134, 232, 837
SduI GDGCHC 2 cut(s) 643, 673
SfaNI GCATC 1 cut(s) 595
SfcI CTRYAG 2 cut(s) 324, 782
SfuI TTCGAA 1 cut(s) 503
SinI GGWCC 5 cut(s) 476, 698, 880, 974, 1002
SmiMI CAYNNNNRTG 1 cut(s) 1035
Sse9I AATT 8 cut(s) 267, 278, 352, 553, 588, 662, 677, 1067
SsiI CCGC 2 cut(s) 144, 235
SspI AATATT 2 cut(s) 339, 399
SspMI CTAG 2 cut(s) 651, 872
StyD4I CCNGG 3 cut(s) 132, 230, 835
StyI CCWWGG 1 cut(s) 174
TaaI ACNGT 1 cut(s) 529
TaiI ACGT 1 cut(s) 864
TaqI TCGA 5 cut(s) 164, 432, 503, 521, 1120
TaqII GACCGA 1 cut(s) 990
TasI AATT 8 cut(s) 267, 278, 352, 553, 588, 662, 677, 1067
TatI WGTACW 3 cut(s) 495, 786, 992
TfiI GAWTC 3 cut(s) 46, 128, 1105
Tru1I TTAA 1 cut(s) 1129
Tru9I TTAA 1 cut(s) 1129
TseI GCWGC 3 cut(s) 86, 781, 1043
TspDTI ATGAA 3 cut(s) 395, 601, 1118
Tth111I GACNNNGTC 1 cut(s) 169
Van91I CCANNNNNTGG 1 cut(s) 757
VpaK11BI GGWCC 5 cut(s) 476, 698, 880, 974, 1002
XapI RAATTY 2 cut(s) 588, 677
XceI RCATGY 1 cut(s) 1013
XmiI GTMKAC 1 cut(s) 164
XspI CTAG 2 cut(s) 651, 872
Zsp2I ATGCAT 1 cut(s) 610
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.