Rmu_sc0001889.1_g000034

Belongs to the 'GDSL' lipolytic enzyme family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001889.1
Physical Location & Seq
Reverse (-)
109265 .. 112162
2898 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001889.1_g000034.1.cds

Sequence Viewer

Length: 1068 bp
atggtgaagaaaatgtgggtggtgtgtgtggtggttttggtattgaacttggggtggtgcaatattggggcaagagctgagccacaagtgccttgctatttcatttttggggattctttggttgataatggcaacaacaaccagcttcagtccttggctagagctgattacttgccttatgggatcgacttcggtggaccaactggaagattttccaatgggaaaactactgttgatgttgttgctgagcttttgggttttgatgattacattccaccctatgcaactgccagaggccaacaaatactcggaggagtaaactttgcatctgcagctgctggaattagagaggaaactggacgccaactgggcggtcggattacgtttagtggtcaggtaaggaattaccaaaacacagtttccgaagtggtaaacttgctaggagatgaggacacagctgcaaattatctggccaaatgcatatactctattggattaggcagcaacgactaccttaacaactattttatgccccaatattacaacaccggaagtcaatacactccggaggaatatgctacttctcttattcaggattacagccagcaactacgggttgtgttgtttggaattggtcaagtaggttgcagtccaagtgaattggctcaaaatagcccagatggaaatacatgcgtcgacaagataaactctgcaaaccaaatcttcaatggcaagctcaaggcccttgccaatgagttcaacactaatttcccagatggaagatttatcttcatagactcctatggcatttttgaggacatagtaaaaagcccagcacaatacggatttacgaatataaatacaggatgctgtggggtggggaggaacaatggccaaatcacatgtcttccttaccaaactccttgttcaaatcgtaacgagtatctgttttgggatgcattccatcccactgaagctggaaatgctgtggttgctaggagatcatacaatgccgttcgtgcatccgatgcttacccagttgatatagccaacctagctgcgctctag

Protein Analysis

355

Amino Acids

38.77

Weight (kDa)

4.71

Isoelectric Point (pI)

28.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014308)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G29670 AT1G29670 AT5G45670
fragaria_vesca FvH4_3g06610
malus_domestica MD00G1093600.v1.1 MD10G1270600.v1.1
prunus_persica Prupe.4G071100_v2.0.a1
pyrus_communis pycom05g27060 pycom10g22640
rosa_chinensis RchiOBHm_Chr5g0012531
rosa_laevigata RLG00000031922
rosa_multiflora Rmu_sc0001889.1_g000034
rosa_roxburghii Rroxscaffold_1G00064160
rosa_rugosa Rorug05G0002200
rosa_samantha Rh5AG096200 Rh5CG105300
rosa_wichuraiana Rw5G008420

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 696
AccIII TCCGGA 1 cut(s) 565
AciI CCGC 1 cut(s) 372
AclWI GGATC 1 cut(s) 191
AcoI YGGCCR 2 cut(s) 471, 892
AcuI CTGAAG 2 cut(s) 131, 993
AcyI GRCGYC 1 cut(s) 361
AflIII ACRYGT 1 cut(s) 902
AgsI TTSAA 4 cut(s) 46, 727, 760, 930
AluBI AGCT 9 cut(s) 77, 145, 164, 250, 335, 458, 736, 977, 1058
AluI AGCT 9 cut(s) 77, 145, 164, 250, 335, 458, 736, 977, 1058
AlwI GGATC 1 cut(s) 191
AlwNI CAGNNNCTG 1 cut(s) 338
Aor13HI TCCGGA 1 cut(s) 565
AoxI GGCC 4 cut(s) 295, 471, 741, 892
ApeKI GCWGC 5 cut(s) 332, 335, 458, 501, 1058
ArsI GACNNNNNNTTYG 2 cut(s) 889, 921
Asp700I GAANNNNTTC 1 cut(s) 211
AspLEI GCGC 1 cut(s) 1063
AspS9I GGNCC 2 cut(s) 197, 742
AsuHPI GGTGA 1 cut(s) 16
AvaII GGWCC 1 cut(s) 197
BalI TGGCCA 2 cut(s) 473, 894
BbsI GAAGAC 1 cut(s) 899
BbvI GCAGC 5 cut(s) 322, 344, 445, 513, 1045
BccI CCATC 3 cut(s) 674, 770, 972
BceAI ACGGC 1 cut(s) 998
BfaI CTAG 5 cut(s) 159, 440, 996, 1055, 1066
BfmI CTRYAG 1 cut(s) 330
BglI GCCNNNNNGGC 1 cut(s) 369
BisI GCNGC 5 cut(s) 333, 336, 459, 502, 1059
BlpI GCTNAGC 2 cut(s) 78, 246
BlsI GCNGC 5 cut(s) 334, 337, 460, 503, 1060
Bme18I GGWCC 1 cut(s) 197
BmgT120I GGNCC 2 cut(s) 197, 742
BmrI ACTGGG 2 cut(s) 377, 1031
BmsI GCATC 5 cut(s) 335, 857, 946, 1018, 1031
BmuI ACTGGG 2 cut(s) 377, 1031
BpiI GAAGAC 1 cut(s) 899
Bpu1102I GCTNAGC 2 cut(s) 78, 246
BpuEI CTTGAG 1 cut(s) 722
BsaHI GRCGYC 1 cut(s) 361
BsaJI CCNNGG 1 cut(s) 153
BsaWI WCCGGW 2 cut(s) 548, 565
Bse1I ACTGG 4 cut(s) 208, 361, 372, 1037
BseAI TCCGGA 1 cut(s) 565
BseDI CCNNGG 1 cut(s) 153
BseGI GGATG 4 cut(s) 872, 961, 964, 1022
BseMII CTCAG 2 cut(s) 69, 237
BseNI ACTGG 4 cut(s) 208, 361, 372, 1037
BseRI GAGGAG 1 cut(s) 327
BseXI GCAGC 5 cut(s) 322, 344, 445, 513, 1045
BseYI CCCAGC 1 cut(s) 832
Bsh1285I CGRYCG 1 cut(s) 376
BshFI GGCC 4 cut(s) 297, 473, 743, 894
BsiEI CGRYCG 1 cut(s) 376
BsiSI CCGG 2 cut(s) 549, 566
BsmI GAATGC 1 cut(s) 959
BsnI GGCC 4 cut(s) 297, 473, 743, 894
Bsp13I TCCGGA 1 cut(s) 565
Bsp143I GATC 2 cut(s) 183, 1001
Bsp1720I GCTNAGC 2 cut(s) 78, 246
BspACI CCGC 1 cut(s) 372
BspANI GGCC 4 cut(s) 297, 473, 743, 894
BspCNI CTCAG 2 cut(s) 70, 238
BspEI TCCGGA 1 cut(s) 565
BspMAI CTGCAG 1 cut(s) 334
BspPI GGATC 1 cut(s) 191
BsrI ACTGG 4 cut(s) 208, 361, 372, 1037
BssECI CCNNGG 1 cut(s) 153
BssMI GATC 2 cut(s) 183, 1001
BssNI GRCGYC 1 cut(s) 361
BssT1I CCWWGG 1 cut(s) 153
Bst4CI ACNGT 2 cut(s) 232, 418
BstACI GRCGYC 1 cut(s) 361
BstAPI GCANNNNNTGC 1 cut(s) 1028
BstC8I GCNNGC 2 cut(s) 605, 734
BstDEI CTNAG 2 cut(s) 78, 246
BstF5I GGATG 4 cut(s) 872, 961, 964, 1022
BstHHI GCGC 1 cut(s) 1063
BstKTI GATC 2 cut(s) 186, 1004
BstMBI GATC 2 cut(s) 183, 1001
BstMCI CGRYCG 1 cut(s) 376
BstMWI GCNNNNNNNGC 8 cut(s) 88, 332, 369, 983, 992, 1019, 1028, 1055
BstNSI RCATGY 2 cut(s) 693, 906
BstSFI CTRYAG 1 cut(s) 330
BstV1I GCAGC 5 cut(s) 322, 344, 445, 513, 1045
BstV2I GAAGAC 1 cut(s) 899
BsuRI GGCC 4 cut(s) 297, 473, 743, 894
BtsCI GGATG 4 cut(s) 872, 961, 964, 1022
BtsIMutI CAGTG 1 cut(s) 969
Cac8I GCNNGC 2 cut(s) 605, 734
CaiI CAGNNNCTG 1 cut(s) 338
CfoI GCGC 1 cut(s) 1063
Cfr13I GGNCC 2 cut(s) 197, 742
CseI GACGC 2 cut(s) 369, 682
CviAII CATG 2 cut(s) 690, 903
DdeI CTNAG 2 cut(s) 78, 246
DpnI GATC 2 cut(s) 185, 1003
DpnII GATC 2 cut(s) 183, 1001
EaeI YGGCCR 2 cut(s) 471, 892
Eco130I CCWWGG 1 cut(s) 153
Eco47I GGWCC 1 cut(s) 197
Eco57I CTGAAG 2 cut(s) 131, 993
EcoO109I RGGNCCY 1 cut(s) 742
EcoT14I CCWWGG 1 cut(s) 153
EcoT22I ATGCAT 2 cut(s) 482, 961
ErhI CCWWGG 1 cut(s) 153
FaeI CATG 2 cut(s) 693, 906
FatI CATG 2 cut(s) 689, 902
FblI GTMKAC 1 cut(s) 696
Fnu4HI GCNGC 5 cut(s) 333, 336, 459, 502, 1059
FokI GGATG 4 cut(s) 879, 951, 968, 1009
Fsp4HI GCNGC 5 cut(s) 333, 336, 459, 502, 1059
FspBI CTAG 5 cut(s) 159, 440, 996, 1055, 1066
GlaI GCGC 1 cut(s) 1062
GluI GCNGC 5 cut(s) 333, 336, 459, 502, 1059
GsaI CCCAGC 1 cut(s) 836
HaeIII GGCC 4 cut(s) 297, 473, 743, 894
HapII CCGG 2 cut(s) 549, 566
HgaI GACGC 2 cut(s) 369, 682
HhaI GCGC 1 cut(s) 1063
Hin1I GRCGYC 1 cut(s) 361
Hin1II CATG 2 cut(s) 693, 906
Hin6I GCGC 1 cut(s) 1061
HinP1I GCGC 1 cut(s) 1061
HincII GTYRAC 1 cut(s) 697
HindII GTYRAC 1 cut(s) 697
HinfI GANTC 2 cut(s) 113, 797
HpaII CCGG 2 cut(s) 549, 566
HphI GGTGA 1 cut(s) 16
Hpy166II GTNNAC 4 cut(s) 197, 319, 433, 697
Hpy188I TCNGA 4 cut(s) 311, 378, 424, 1027
Hpy188III TCNNGA 2 cut(s) 566, 593
Hpy8I GTNNAC 4 cut(s) 197, 319, 433, 697
Hpy99I CGWCG 1 cut(s) 698
HpyCH4III ACNGT 2 cut(s) 232, 418
HpyCH4IV ACGT 1 cut(s) 383
HpyF10VI GCNNNNNNNGC 8 cut(s) 88, 332, 369, 983, 992, 1019, 1028, 1055
HpyF3I CTNAG 2 cut(s) 78, 246
HpySE526I ACGT 1 cut(s) 383
Hsp92I GRCGYC 1 cut(s) 361
Hsp92II CATG 2 cut(s) 693, 906
HspAI GCGC 1 cut(s) 1061
Kpn2I TCCGGA 1 cut(s) 565
Kzo9I GATC 2 cut(s) 183, 1001
Lsp1109I GCAGC 5 cut(s) 322, 344, 445, 513, 1045
LweI GCATC 5 cut(s) 335, 857, 946, 1018, 1031
MaeI CTAG 5 cut(s) 159, 440, 996, 1055, 1066
MaeII ACGT 1 cut(s) 383
MaeIII GTNAC 1 cut(s) 935
MalI GATC 2 cut(s) 185, 1003
MboI GATC 2 cut(s) 183, 1001
MboII GAAGA 6 cut(s) 19, 219, 715, 781, 792, 899
MlsI TGGCCA 2 cut(s) 473, 894
MluCI AATT 6 cut(s) 342, 403, 463, 630, 659, 766
MluNI TGGCCA 2 cut(s) 473, 894
MlyI GAGTC 1 cut(s) 791
MmeI TCCRAC 1 cut(s) 356
MnlI CCTC 7 cut(s) 287, 305, 343, 442, 562, 808, 876
Mox20I TGGCCA 2 cut(s) 473, 894
Mph1103I ATGCAT 2 cut(s) 482, 961
MroI TCCGGA 1 cut(s) 565
MroXI GAANNNNTTC 1 cut(s) 211
MscI TGGCCA 2 cut(s) 473, 894
MseI TTAA 1 cut(s) 516
Msp20I TGGCCA 2 cut(s) 473, 894
MspA1I CMGCKG 2 cut(s) 335, 458
MspI CCGG 2 cut(s) 549, 566
Mva1269I GAATGC 1 cut(s) 959
MwoI GCNNNNNNNGC 8 cut(s) 88, 332, 369, 983, 992, 1019, 1028, 1055
NdeII GATC 2 cut(s) 183, 1001
NlaIII CATG 2 cut(s) 693, 906
NsiI ATGCAT 2 cut(s) 482, 961
NspI RCATGY 2 cut(s) 693, 906
PciI ACATGT 1 cut(s) 902
PctI GAATGC 1 cut(s) 959
PdmI GAANNNNTTC 1 cut(s) 211
PfeI GAWTC 1 cut(s) 113
PkrI GCNGC 5 cut(s) 334, 337, 460, 503, 1060
PleI GAGTC 1 cut(s) 791
PpsI GAGTC 1 cut(s) 791
PscI ACATGT 1 cut(s) 902
PspFI CCCAGC 1 cut(s) 832
PspPI GGNCC 2 cut(s) 197, 742
PstI CTGCAG 1 cut(s) 334
PstNI CAGNNNCTG 1 cut(s) 338
PvuII CAGCTG 2 cut(s) 335, 458
SalI GTCGAC 1 cut(s) 695
SaqAI TTAA 1 cut(s) 516
SatI GCNGC 5 cut(s) 333, 336, 459, 502, 1059
Sau3AI GATC 2 cut(s) 183, 1001
Sau96I GGNCC 2 cut(s) 197, 742
SchI GAGTC 1 cut(s) 791
SfaNI GCATC 5 cut(s) 335, 857, 946, 1018, 1031
SfcI CTRYAG 1 cut(s) 330
SinI GGWCC 1 cut(s) 197
SmlI CTYRAG 1 cut(s) 737
SmoI CTYRAG 1 cut(s) 737
Sse9I AATT 6 cut(s) 342, 403, 463, 630, 659, 766
SsiI CCGC 1 cut(s) 372
SspI AATATT 2 cut(s) 64, 539
SspMI CTAG 5 cut(s) 159, 440, 996, 1055, 1066
StyI CCWWGG 1 cut(s) 153
TaaI ACNGT 2 cut(s) 232, 418
TaiI ACGT 1 cut(s) 386
TaqI TCGA 2 cut(s) 186, 696
TasI AATT 6 cut(s) 342, 403, 463, 630, 659, 766
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 1 cut(s) 516
Tru9I TTAA 1 cut(s) 516
TscAI CASTG 1 cut(s) 976
TseI GCWGC 5 cut(s) 332, 335, 458, 501, 1058
TspDTI ATGAA 2 cut(s) 91, 781
TspGWI ACGGA 1 cut(s) 858
TspRI CASTG 1 cut(s) 976
VpaK11BI GGWCC 1 cut(s) 197
XceI RCATGY 2 cut(s) 693, 906
XcmI CCANNNNNNNNNTGG 1 cut(s) 725
XmiI GTMKAC 1 cut(s) 696
XmnI GAANNNNTTC 1 cut(s) 211
XspI CTAG 5 cut(s) 159, 440, 996, 1055, 1066
Zsp2I ATGCAT 2 cut(s) 482, 961
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.