Rmu_sc0002030.1_g000005

Splicing factor 3B subunit

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002030.1
Physical Location & Seq
Reverse (-)
28065 .. 31877
3813 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002030.1_g000005.1.cds

Sequence Viewer

Length: 3813 bp
atgtcagacccagagatagccaagactcaggaggagcgcaagaggatggagcagcaattggcctccatgaactccgtcacctacgacgaggaattctacggcgccaccaacaagtccgattacgtctcctccatccccgtcaacgacgaggacgagaatctcgaccccatggacaacgacgtcgctcggagaatggcctcctacaccgcccccaagtccctgatgaacgacatgcccagaggcggcgacgccgacgacgacgacgcctccgggatgcccaagtccaagaagattatcgaccgcgaggacgattatcgccgccggaggctgaatcggatcatatcgccggagcggcacgacccgtttgctgccggcgagaagactcccgacccgtctgtgaggacttatgccgagattatgagagaggaggcgctgaagagggagaaggaagagactctgaggcttattgccaagaagaagaaggaggaagaggaatcggggaaggcggccccgccaccgccggagaaggcaggaggggctcagaagaggaggaataggtgggaccagtcccaggatggggatgctggagcggaggcagttaagaaggccaagacgacgtcggattgggacttgcctgatgcaactcccggaaggtgggatgccactccgacgcccgggagagtagctgatgcgactcccgggatggggaggaggaaccgttgggatgagacacccactcccggtagggttgtggattctgatgccactccagctggaggcgctactcctggtgccactccggctgggatgacttgggatgcgaccccgaagcttccggggatggccacacctacaccgaaaagacagaggtctaggtgggatgagacccctgctaccatgggcagtgcgacgccagggtctgtggcaactcctggtccaggtgggtacacacctggtgtcactcctgctggtggagctgggcttgagaccccgacaccagggaccattaatctgcgcggtcccattacgccggagcagtacaatctgttgaggtgggagaaggatattgaggagaggaataggcctttgactgatgaagagctggattctatgtttccacaagagggttacaagattttggatccaccaccaacttatgtgccgattaggaccccagccaggaagttggtggcaaccccaactccgatgatgactcctcagtatgctattccagaagagaatcgtgggcagcagtttgatgtgcccaaggagcttccaggtggcttgccgtttatgaagccagaggactaccagtactttggtgctttgttgaatgaagatgaggaggaggagttgtcccctgatgagcagaaagagaggaagattatgaagcttttgctcaaggttaagaatggtacaccaccgcagaggaagacagcattgaggcagcttactgataaagctcgtgactttggtgctggcccattgttcaaccgcattctccctttgctaatgcagcccactttggaagatcaagagcggcatcttttggttaaggtaattgatagagtgctttataaattggatgaattggtacgcccttatgtgcataaaattcttgttgtgattgaacctctattgattgatgaagactattatgcacgtgttgaagggagagaaattatctccaatcttagtaaagcagctggtttggctactatgattgcagccatgcgtccagatattgataacattgatgaatatgttagaaatactactgctagagctttcagtgttgtggcctctgctcttggtattcctgccctgttaccattcttgaaagctgtctgtcagagcaagaaatcatggcaagcacggcacactggaatcaagattgttcagcagattgcaattttaattgggtgtgctgttcttcctcacttgaggtctcttgtggaaattatagagaatggtctgagtgatgaaaatcagaaggtcaggactattactgctctatctcttgctgctcttgccgaagctgctgccccttacggtattgaaagcttcgactctgtcttgaagccattgtggaagggtattaggtctcaccgtggtaaggttttggctgctttcttgaaggccatcggtttcattattcctcttatggatgcattgtatgctagttactatacaaaagaagtgatggttatattgattagagagttccagtctcctgatgaggaaatgaagaaaatagtgctcaaggtggtgaaacaatgtgtgagtacagaaggtgtggaggctgattacataaggaatgacattctccctgagttcttcagaaacttctgggttagaaggatggctttggataggagaaactacaggcaactggtggaaacaactgtggagatagcaaacaaagtgggtgttgctgatatagtagggaggattgtagaggatcttaaagatgagagtgaaccatataggcgaatggttatggagacaattgagaaggtggttgttaacttgggtgcttctgatattgatgctcggttggaggagcttctcatcgatggtatcctttatgccttccaagagcagaccagtgatgatgcaaatgtcatgcttaatgggtttggtgcagttgtgaattctcttgggcagagggtgaaaccttaccttccccagatttgtggtaccatcaagtggcgtttgaataacaagagtgcaaaggtcagacagcaagctgcagaccttatttcaaggattgctgttgtcatgaagcagtgccaagaggaacaactgatgggtcatcttggtgttgtcttgtatgagtatttaggagaagagtacccagaagttctcggatcaattctgggagcactaaaggcaattgttaatgttattggtatgacaaagatgactcctccgatcaaagatctgcttcccagattaactccaattttgaagaataggcatgagaaagtccaggagaactgtatagacctggttggtcgtattgctgaccgtggtgctgagtttgttccagctagggagtggatgaggatctgttttgagcttcttgagatgctcaaggcccataagaagggtatccggcgagctacagtgaacacttttgggtacattgcgaaagccattggcccacaagatgtccttgctactctgctgaacaatctgaaggtgcaagagcgtcagaaccgtgtttgcaccaccgtggctattgcaatagtagcggaaacatgttctccttttactgttctgccagcgctgatgaatgagtaccgtgttccagagcttaatgttcagaatggtgttttgaaatctctctctttcctgtttgagtacattggtgaaatggggaaagactatatctatgcagtgaccccattgcttgaggatgccttgatggacagagatctggttcacaggcaaactgcagcttctgctgtaaagcacatggctttgggagtagctggattgggttgcgaggacgcgttagtccacttgctaaactatgtgtggccaaacatctttgagacatctccacatgttattaatgctgtgatggaagccatcgaagggatgagagtggcgttgggtgctgctgttgttcttaactactgtctccagggactgttccatcctgctaggaaggttagggaggtgtactggaagatctacaactcgctatatattggagctcaagatgctcttgtggcagcctatcctatgctggaagatgaggagcataacgtgtacactaggcctgagttaatgatgtttgtttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

1270

Amino Acids

141.98

Weight (kDa)

5.65

Isoelectric Point (pI)

45.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1578
AasI GACNNNNNNGTC 3 cut(s) 179, 916, 3521
AatII GACGTC 2 cut(s) 183, 620
Acc65I GGTACC 1 cut(s) 2699
AccB1I GGYRCC 3 cut(s) 101, 791, 2699
AccB7I CCANNNNNTGG 1 cut(s) 2709
AccBSI CCGCTC 3 cut(s) 352, 590, 1540
AccII CGCG 3 cut(s) 303, 1017, 3518
AclWI GGATC 6 cut(s) 344, 1136, 1149, 2469, 2878, 3077
AcoI YGGCCR 2 cut(s) 843, 3545
AcsI RAATTY 3 cut(s) 92, 1614, 2653
AcuI CTGAAG 3 cut(s) 455, 2323, 3221
AcvI CACGTG 1 cut(s) 1664
AcyI GRCGYC 7 cut(s) 102, 180, 249, 264, 617, 671, 911
AdeI CACNNNGTG 1 cut(s) 956
AfeI AGCGCT 1 cut(s) 3291
AflIII ACRYGT 5 cut(s) 1663, 3263, 3516, 3571, 3777
AleI CACNNNNGTG 1 cut(s) 3236
Alw21I GWGCWC 3 cut(s) 2262, 2887, 3727
AlwI GGATC 6 cut(s) 344, 1136, 1149, 2469, 2878, 3077
AlwNI CAGNNNCTG 3 cut(s) 920, 3467, 3658
Ama87I CYCGRG 2 cut(s) 674, 698
Aor51HI AGCGCT 1 cut(s) 3291
ApoI RAATTY 3 cut(s) 92, 1614, 2653
AseI ATTAAT 2 cut(s) 1008, 3579
Asp718I GGTACC 1 cut(s) 2699
AspLEI GCGC 6 cut(s) 39, 104, 433, 782, 1017, 3292
AspS9I GGNCC 9 cut(s) 508, 562, 935, 1002, 1019, 1170, 1481, 3100, 3164
AsuC2I CCSGG 8 cut(s) 271, 648, 675, 676, 699, 700, 741, 837
AsuHPI GGTGA 5 cut(s) 70, 2099, 2281, 2683, 3386
AvaI CYCGRG 2 cut(s) 674, 698
AvaII GGWCC 5 cut(s) 562, 935, 1002, 1019, 1170
BaeGI GKGCMC 1 cut(s) 1266
BalI TGGCCA 2 cut(s) 845, 3547
BamHI GGATCC 1 cut(s) 1141
BanI GGYRCC 3 cut(s) 101, 791, 2699
BanII GRGCYC 2 cut(s) 541, 3727
BauI CACGAG 1 cut(s) 1464
BbrPI CACGTG 1 cut(s) 1664
BbsI GAAGAC 3 cut(s) 386, 1439, 1656
Bbv12I GWGCWC 3 cut(s) 2262, 2887, 3727
BceAI ACGGC 3 cut(s) 115, 1273, 1892
BcgI CGANNNNNNTGC 4 cut(s) 347, 381, 2024, 2058
BciVI GTATCC 2 cut(s) 2591, 3125
BcnI CCSGG 8 cut(s) 271, 648, 675, 676, 699, 700, 741, 837
BfaI CTAG 6 cut(s) 873, 1782, 2181, 3054, 3672, 3786
BfmI CTRYAG 4 cut(s) 2383, 2751, 3126, 3459
BfoI RGCGCY 4 cut(s) 105, 434, 783, 3293
BfuI GTATCC 2 cut(s) 2591, 3125
BglI GCCNNNNNGGC 2 cut(s) 352, 800
BglII AGATCT 3 cut(s) 2941, 3439, 3699
BmcAI AGTACT 1 cut(s) 1316
Bme18I GGWCC 5 cut(s) 562, 935, 1002, 1019, 1170
BmeT110I CYCGRG 2 cut(s) 674, 698
BmgT120I GGNCC 9 cut(s) 508, 562, 935, 1002, 1019, 1170, 1481, 3100, 3164
BoxI GACNNNNGTC 1 cut(s) 868
BpiI GAAGAC 3 cut(s) 386, 1439, 1656
BpmI CTGGAG 4 cut(s) 606, 753, 795, 3635
BpuEI CTTGAG 8 cut(s) 1004, 1385, 1963, 2246, 3080, 3107, 3437, 3711
BpuMI CCSGG 8 cut(s) 271, 648, 675, 676, 699, 700, 741, 837
Bsa29I ATCGAT 1 cut(s) 2574
BsaAI YACGTR 1 cut(s) 1664
BsaBI GATNNNNATC 2 cut(s) 1986, 3068
BsaHI GRCGYC 7 cut(s) 102, 180, 249, 264, 617, 671, 911
BsaI GGTCTC 4 cut(s) 878, 980, 1953, 2109
Bse118I RCCGGY 1 cut(s) 371
Bse1I ACTGG 7 cut(s) 565, 1312, 1888, 2227, 2397, 2607, 3698
Bse3DI GCAATG 2 cut(s) 3147, 3410
Bse8I GATNNNNATC 2 cut(s) 1986, 3068
BseCI ATCGAT 1 cut(s) 2574
BseJI GATNNNNATC 2 cut(s) 1986, 3068
BseMI GCAATG 2 cut(s) 3147, 3410
BseMII CTCAG 8 cut(s) 41, 449, 554, 1232, 1967, 2322, 3030, 3783
BseNI ACTGG 7 cut(s) 565, 1312, 1888, 2227, 2397, 2607, 3698
BseSI GKGCMC 1 cut(s) 1266
BseYI CCCAGC 3 cut(s) 803, 977, 1174
BsgI GTGCAG 1 cut(s) 2664
Bsh1236I CGCG 3 cut(s) 303, 1017, 3518
Bsh1285I CGRYCG 1 cut(s) 301
BshNI GGYRCC 3 cut(s) 101, 791, 2699
BshVI ATCGAT 1 cut(s) 2574
BsiEI CGRYCG 1 cut(s) 301
BsiHKAI GWGCWC 3 cut(s) 2262, 2887, 3727
BsiHKCI CYCGRG 2 cut(s) 674, 698
BslFI GGGAC 8 cut(s) 202, 553, 575, 641, 1005, 1015, 1342, 3669
BsmBI CGTCTC 1 cut(s) 130
BsmFI GGGAC 8 cut(s) 202, 553, 575, 641, 1005, 1015, 1342, 3669
BsmI GAATGC 1 cut(s) 1497
Bso31I GGTCTC 4 cut(s) 878, 980, 1953, 2109
BsoBI CYCGRG 2 cut(s) 674, 698
Bsp1286I GDGCHC 5 cut(s) 541, 1266, 2262, 2887, 3727
Bsp1407I TGTACA 1 cut(s) 3780
Bsp19I CCATGG 2 cut(s) 168, 897
BspCNI CTCAG 8 cut(s) 40, 450, 553, 1231, 1968, 2323, 3031, 3784
BspDI ATCGAT 1 cut(s) 2574
BspFNI CGCG 3 cut(s) 303, 1017, 3518
BspHI TCATGA 1 cut(s) 2781
BspMAI CTGCAG 2 cut(s) 2755, 3463
BspPI GGATC 6 cut(s) 344, 1136, 1149, 2469, 2878, 3077
BspQI GCTCTTC 1 cut(s) 1092
BspT107I GGYRCC 3 cut(s) 101, 791, 2699
BspTNI GGTCTC 4 cut(s) 878, 980, 1953, 2109
BsrBI CCGCTC 3 cut(s) 352, 590, 1540
BsrDI GCAATG 2 cut(s) 3147, 3410
BsrFI RCCGGY 1 cut(s) 371
BsrGI TGTACA 1 cut(s) 3780
BsrI ACTGG 7 cut(s) 565, 1312, 1888, 2227, 2397, 2607, 3698
BssAI RCCGGY 1 cut(s) 371
BssNI GRCGYC 7 cut(s) 102, 180, 249, 264, 617, 671, 911
BssSI CACGAG 1 cut(s) 1464
BssT1I CCWWGG 3 cut(s) 168, 897, 1266
Bst2BI CACGAG 1 cut(s) 1464
Bst6I CTCTTC 7 cut(s) 431, 444, 483, 539, 1092, 1230, 2844
BstACI GRCGYC 7 cut(s) 102, 180, 249, 264, 617, 671, 911
BstAPI GCANNNNNTGC 2 cut(s) 2177, 3467
BstAUI TGTACA 1 cut(s) 3780
BstBAI YACGTR 1 cut(s) 1664
BstC8I GCNNGC 7 cut(s) 373, 1286, 1480, 1872, 2748, 3123, 3288
BstDEI CTNAG 9 cut(s) 27, 458, 540, 1218, 1694, 1976, 2331, 3039, 3792
BstDSI CCRYGG 5 cut(s) 168, 897, 2110, 3031, 3237
BstENI CCTNNNNNAGG 1 cut(s) 936
BstFNI CGCG 3 cut(s) 303, 1017, 3518
BstH2I RGCGCY 4 cut(s) 105, 434, 783, 3293
BstHHI GCGC 6 cut(s) 39, 104, 433, 782, 1017, 3292
BstMCI CGRYCG 1 cut(s) 301
BstNSI RCATGY 3 cut(s) 235, 3267, 3575
BstPAI GACNNNNGTC 1 cut(s) 868
BstSFI CTRYAG 4 cut(s) 2383, 2751, 3126, 3459
BstSLI GKGCMC 1 cut(s) 1266
BstUI CGCG 3 cut(s) 303, 1017, 3518
BstV2I GAAGAC 3 cut(s) 386, 1439, 1656
BstX2I RGATCY 6 cut(s) 1141, 2461, 2941, 3069, 3439, 3699
BstXI CCANNNNNNTGG 3 cut(s) 1186, 1319, 2696
BstYI RGATCY 6 cut(s) 1141, 2461, 2941, 3069, 3439, 3699
Bsu15I ATCGAT 1 cut(s) 2574
BsuI GTATCC 2 cut(s) 2591, 3125
BsuTUI ATCGAT 1 cut(s) 2574
BtgI CCRYGG 5 cut(s) 168, 897, 2110, 3031, 3237
BtsI GCAGTG 3 cut(s) 910, 2795, 3408
BtsIMutI CAGTG 7 cut(s) 910, 1798, 1881, 2614, 2795, 3135, 3408
Cac8I GCNNGC 7 cut(s) 373, 1286, 1480, 1872, 2748, 3123, 3288
CaiI CAGNNNCTG 3 cut(s) 920, 3467, 3658
CciI TCATGA 1 cut(s) 2781
CfoI GCGC 6 cut(s) 39, 104, 433, 782, 1017, 3292
Cfr10I RCCGGY 1 cut(s) 371
Cfr13I GGNCC 9 cut(s) 508, 562, 935, 1002, 1019, 1170, 1481, 3100, 3164
Cfr9I CCCGGG 2 cut(s) 674, 698
ClaI ATCGAT 1 cut(s) 2574
CseI GACGC 7 cut(s) 257, 272, 679, 919, 1724, 3203, 3524
CsiI ACCWGGT 2 cut(s) 952, 3009
CspCI CAANNNNNGTGG 2 cut(s) 2406, 2441
DdeI CTNAG 9 cut(s) 27, 458, 540, 1218, 1694, 1976, 2331, 3039, 3792
DinI GGCGCC 1 cut(s) 103
DraIII CACNNNGTG 1 cut(s) 956
DrdI GACNNNNNNGTC 3 cut(s) 179, 916, 3521
DseDI GACNNNNNNGTC 3 cut(s) 179, 916, 3521
EaeI YGGCCR 2 cut(s) 843, 3545
Eam1104I CTCTTC 7 cut(s) 431, 444, 483, 539, 1092, 1230, 2844
EarI CTCTTC 7 cut(s) 431, 444, 483, 539, 1092, 1230, 2844
Ecl136II GAGCTC 1 cut(s) 3725
Eco130I CCWWGG 3 cut(s) 168, 897, 1266
Eco147I AGGCCT 2 cut(s) 1084, 3790
Eco24I GRGCYC 2 cut(s) 541, 3727
Eco31I GGTCTC 4 cut(s) 878, 980, 1953, 2109
Eco47I GGWCC 5 cut(s) 562, 935, 1002, 1019, 1170
Eco47III AGCGCT 1 cut(s) 3291
Eco53kI GAGCTC 1 cut(s) 3725
Eco57I CTGAAG 3 cut(s) 455, 2323, 3221
Eco72I CACGTG 1 cut(s) 1664
Eco88I CYCGRG 2 cut(s) 674, 698
EcoICRI GAGCTC 1 cut(s) 3725
EcoNI CCTNNNNNAGG 1 cut(s) 936
EcoO109I RGGNCCY 1 cut(s) 1170
EcoRI GAATTC 2 cut(s) 92, 2653
EcoT14I CCWWGG 3 cut(s) 168, 897, 1266
EcoT22I ATGCAT 1 cut(s) 2173
EcoT38I GRGCYC 2 cut(s) 541, 3727
EgeI GGCGCC 1 cut(s) 103
EheI GGCGCC 1 cut(s) 103
ErhI CCWWGG 3 cut(s) 168, 897, 1266
Esp3I CGTCTC 1 cut(s) 130
FalI AAGNNNNNCTT 8 cut(s) 2350, 2382, 2931, 2963, 3162, 3194, 3720, 3752
FaqI GGGAC 8 cut(s) 202, 553, 575, 641, 1005, 1015, 1342, 3669
FauI CCCGC 1 cut(s) 519
FriOI GRGCYC 2 cut(s) 541, 3727
FspBI CTAG 6 cut(s) 873, 1782, 2181, 3054, 3672, 3786
GlaI GCGC 6 cut(s) 38, 103, 432, 781, 1016, 3291
GsaI CCCAGC 3 cut(s) 807, 981, 1178
GsuI CTGGAG 4 cut(s) 606, 753, 795, 3635
HaeII RGCGCY 4 cut(s) 105, 434, 783, 3293
HgaI GACGC 7 cut(s) 257, 272, 679, 919, 1724, 3203, 3524
HhaI GCGC 6 cut(s) 39, 104, 433, 782, 1017, 3292
Hin1I GRCGYC 7 cut(s) 102, 180, 249, 264, 617, 671, 911
Hin6I GCGC 6 cut(s) 37, 102, 431, 780, 1015, 3290
HinP1I GCGC 6 cut(s) 37, 102, 431, 780, 1015, 3290
HincII GTYRAC 2 cut(s) 142, 2527
HindII GTYRAC 2 cut(s) 142, 2527
HindIII AAGCTT 3 cut(s) 830, 1391, 2062
HpaI GTTAAC 1 cut(s) 2527
HphI GGTGA 5 cut(s) 70, 2099, 2281, 2683, 3386
HpyCH4IV ACGT 5 cut(s) 123, 180, 617, 1663, 3777
HpyF3I CTNAG 9 cut(s) 27, 458, 540, 1218, 1694, 1976, 2331, 3039, 3792
HpySE526I ACGT 5 cut(s) 123, 180, 617, 1663, 3777
Hsp92I GRCGYC 7 cut(s) 102, 180, 249, 264, 617, 671, 911
HspAI GCGC 6 cut(s) 37, 102, 431, 780, 1015, 3290
KasI GGCGCC 1 cut(s) 101
KpnI GGTACC 1 cut(s) 2703
KroI GCCGGC 1 cut(s) 371
KroNI GCCGGC 1 cut(s) 373
KspAI GTTAAC 1 cut(s) 2527
LguI GCTCTTC 1 cut(s) 1092
MabI ACCWGGT 2 cut(s) 952, 3009
MaeI CTAG 6 cut(s) 873, 1782, 2181, 3054, 3672, 3786
MaeII ACGT 5 cut(s) 123, 180, 617, 1663, 3777
MaeIII GTNAC 7 cut(s) 76, 958, 1127, 1466, 1827, 2183, 3403
MbiI CCGCTC 3 cut(s) 352, 590, 1540
MfeI CAATTG 3 cut(s) 56, 2508, 2895
MflI RGATCY 6 cut(s) 1141, 2461, 2941, 3069, 3439, 3699
MhlI GDGCHC 5 cut(s) 541, 1266, 2262, 2887, 3727
MlsI TGGCCA 2 cut(s) 845, 3547
MluI ACGCGT 1 cut(s) 3516
MluNI TGGCCA 2 cut(s) 845, 3547
Mly113I GGCGCC 1 cut(s) 102
MlyI GAGTC 7 cut(s) 19, 376, 448, 688, 1207, 2063, 2920
MmeI TCCRAC 3 cut(s) 600, 692, 2538
Mox20I TGGCCA 2 cut(s) 845, 3547
Mph1103I ATGCAT 1 cut(s) 2173
MroNI GCCGGC 1 cut(s) 371
MscI TGGCCA 2 cut(s) 845, 3547
MslI CAYNNNNRTG 2 cut(s) 2820, 3236
Msp20I TGGCCA 2 cut(s) 845, 3547
MspA1I CMGCKG 2 cut(s) 773, 1706
MunI CAATTG 3 cut(s) 56, 2508, 2895
Mva1269I GAATGC 1 cut(s) 1497
MvnI CGCG 3 cut(s) 303, 1017, 3518
NaeI GCCGGC 1 cut(s) 373
NarI GGCGCC 1 cut(s) 102
NciI CCSGG 8 cut(s) 271, 648, 675, 676, 699, 700, 741, 837
NcoI CCATGG 2 cut(s) 168, 897
NgoMIV GCCGGC 1 cut(s) 371
NmeAIII GCCGAG 1 cut(s) 436
NmuCI GTSAC 4 cut(s) 76, 958, 1466, 3403
NsiI ATGCAT 1 cut(s) 2173
NspI RCATGY 3 cut(s) 235, 3267, 3575
OliI CACNNNNGTG 1 cut(s) 3236
PagI TCATGA 1 cut(s) 2781
PceI AGGCCT 2 cut(s) 1084, 3790
PciI ACATGT 2 cut(s) 3263, 3571
PciSI GCTCTTC 1 cut(s) 1092
PcsI WCGNNNNNNNCGW 3 cut(s) 150, 159, 255
PctI GAATGC 1 cut(s) 1497
PdiI GCCGGC 1 cut(s) 373
PfeI GAWTC 7 cut(s) 157, 331, 494, 755, 1106, 1240, 1887
PflFI GACNNNGTC 2 cut(s) 616, 2072
PflMI CCANNNNNTGG 1 cut(s) 2709
PfoI TCCNGGA 3 cut(s) 269, 646, 2991
PleI GAGTC 7 cut(s) 19, 376, 448, 688, 1207, 2063, 2920
PluTI GGCGCC 1 cut(s) 105
PmaCI CACGTG 1 cut(s) 1664
PmlI CACGTG 1 cut(s) 1664
PpsI GAGTC 7 cut(s) 19, 376, 448, 688, 1207, 2063, 2920
Ppu21I YACGTR 1 cut(s) 1664
PpuMI RGGWCCY 1 cut(s) 1170
PscI ACATGT 2 cut(s) 3263, 3571
PshAI GACNNNNGTC 1 cut(s) 868
PshBI ATTAAT 2 cut(s) 1008, 3579
PsiI TTATAA 1 cut(s) 1578
Psp124BI GAGCTC 1 cut(s) 3727
Psp5II RGGWCCY 1 cut(s) 1170
PspCI CACGTG 1 cut(s) 1664
PspFI CCCAGC 3 cut(s) 803, 977, 1174
PspPI GGNCC 9 cut(s) 508, 562, 935, 1002, 1019, 1170, 1481, 3100, 3164
PspPPI RGGWCCY 1 cut(s) 1170
PstI CTGCAG 2 cut(s) 2755, 3463
PstNI CAGNNNCTG 3 cut(s) 920, 3467, 3658
PsuI RGATCY 6 cut(s) 1141, 2461, 2941, 3069, 3439, 3699
PsyI GACNNNGTC 2 cut(s) 616, 2072
PvuII CAGCTG 2 cut(s) 773, 1706
RseI CAYNNNNRTG 2 cut(s) 2820, 3236
SacI GAGCTC 1 cut(s) 3727
SapI GCTCTTC 1 cut(s) 1092
Sau96I GGNCC 9 cut(s) 508, 562, 935, 1002, 1019, 1170, 1481, 3100, 3164
ScaI AGTACT 1 cut(s) 1316
SchI GAGTC 7 cut(s) 19, 376, 448, 688, 1207, 2063, 2920
SduI GDGCHC 5 cut(s) 541, 1266, 2262, 2887, 3727
SexAI ACCWGGT 2 cut(s) 952, 3009
SfcI CTRYAG 4 cut(s) 2383, 2751, 3126, 3459
SfoI GGCGCC 1 cut(s) 103
SinI GGWCC 5 cut(s) 562, 935, 1002, 1019, 1170
SmaI CCCGGG 2 cut(s) 676, 700
SmiMI CAYNNNNRTG 2 cut(s) 2820, 3236
SmlI CTYRAG 8 cut(s) 983, 1400, 1942, 2261, 3086, 3095, 3416, 3726
SmoI CTYRAG 8 cut(s) 983, 1400, 1942, 2261, 3086, 3095, 3416, 3726
SseBI AGGCCT 2 cut(s) 1084, 3790
SspDI GGCGCC 1 cut(s) 101
SspMI CTAG 6 cut(s) 873, 1782, 2181, 3054, 3672, 3786
SstI GAGCTC 1 cut(s) 3727
StuI AGGCCT 2 cut(s) 1084, 3790
StyI CCWWGG 3 cut(s) 168, 897, 1266
TaiI ACGT 5 cut(s) 126, 183, 620, 1666, 3780
TaqI TCGA 5 cut(s) 162, 297, 2067, 2574, 3600
TatI WGTACW 6 cut(s) 1038, 1314, 2285, 3366, 3690, 3780
TauI GCSGC 5 cut(s) 246, 321, 355, 509, 1543
TfiI GAWTC 7 cut(s) 157, 331, 494, 755, 1106, 1240, 1887
TscAI CASTG 7 cut(s) 910, 1798, 1888, 2614, 2795, 3135, 3408
TseFI GTSAC 4 cut(s) 76, 958, 1466, 3403
Tsp45I GTSAC 4 cut(s) 76, 958, 1466, 3403
TspGWI ACGGA 1 cut(s) 64
TspMI CCCGGG 2 cut(s) 674, 698
TspRI CASTG 7 cut(s) 910, 1798, 1888, 2614, 2795, 3135, 3408
Tth111I GACNNNGTC 2 cut(s) 616, 2072
Van91I CCANNNNNTGG 1 cut(s) 2709
VpaK11BI GGWCC 5 cut(s) 562, 935, 1002, 1019, 1170
VspI ATTAAT 2 cut(s) 1008, 3579
XagI CCTNNNNNAGG 1 cut(s) 936
XapI RAATTY 3 cut(s) 92, 1614, 2653
XceI RCATGY 3 cut(s) 235, 3267, 3575
XcmI CCANNNNNNNNNTGG 3 cut(s) 572, 1186, 3057
XmaI CCCGGG 2 cut(s) 674, 698
XspI CTAG 6 cut(s) 873, 1782, 2181, 3054, 3672, 3786
ZraI GACGTC 2 cut(s) 181, 618
ZrmI AGTACT 1 cut(s) 1316
Zsp2I ATGCAT 1 cut(s) 2173
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.