Rmu_sc0002113.1_g000005

Protein of unknown function (DUF4005)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002113.1
Physical Location & Seq
Reverse (-)
25469 .. 26280
812 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002113.1_g000005.1.cds

Sequence Viewer

Length: 444 bp
atgggctttttccggcgactcttcggcccgaaaaagcccaaaaagaagactaacaaagccgaagcctccacttcagcttctcaagaatggggcttggactccaacaagcacgcaatagcggtggcggcagctactgccgccgtggccgaggcagctctcgcggcggctcatgctgcagcggaggtcgtcaggctcactaacggcgttgagacttcggggaacgttagcttgccagttagagtcagccgtcaccgccacctggccgccgttaagatacagtcagctttccggagatacctggttgtgtcagagtctgggagaagaaattctctgcttgaatctgtgttcctaacaagaaggttactttggtactttctggacatggatttccaaccttccaatgccacattgcagaggaaggacaaagatgtcaatttgcattga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

147

Amino Acids

16.22

Weight (kDa)

10.58

Isoelectric Point (pI)

44.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 428
AccII CGCG 1 cut(s) 161
AccIII TCCGGA 1 cut(s) 288
AciI CCGC 8 cut(s) 119, 125, 138, 161, 164, 179, 253, 264
AclI AACGTT 1 cut(s) 222
AcoI YGGCCR 2 cut(s) 144, 261
AcsI RAATTY 1 cut(s) 325
AcuI CTGAAG 1 cut(s) 57
AfaI GTAC 1 cut(s) 371
AfiI CCNNNNNNNGG 1 cut(s) 259
AgsI TTSAA 1 cut(s) 338
AjnI CCWGG 2 cut(s) 258, 297
AjuI GAANNNNNNNTTGG 2 cut(s) 349, 381
AluBI AGCT 5 cut(s) 77, 131, 155, 228, 284
AluI AGCT 5 cut(s) 77, 131, 155, 228, 284
Alw26I GTCTC 1 cut(s) 203
AlwNI CAGNNNCTG 2 cut(s) 134, 314
Aor13HI TCCGGA 1 cut(s) 288
AoxI GGCC 3 cut(s) 25, 144, 261
ApeKI GCWGC 4 cut(s) 128, 152, 173, 176
ApoI RAATTY 1 cut(s) 325
Asp700I GAANNNNTTC 1 cut(s) 325
AspS9I GGNCC 1 cut(s) 26
AsuHPI GGTGA 1 cut(s) 242
BbsI GAAGAC 1 cut(s) 53
BbvI GCAGC 4 cut(s) 140, 160, 164, 188
BceAI ACGGC 4 cut(s) 125, 217, 231, 251
BciT130I CCWGG 2 cut(s) 260, 299
BcoDI GTCTC 1 cut(s) 203
BfmI CTRYAG 1 cut(s) 174
BglI GCCNNNNNGGC 1 cut(s) 143
BisI GCNGC 9 cut(s) 126, 129, 138, 153, 162, 165, 174, 177, 264
BlsI GCNGC 9 cut(s) 127, 130, 139, 154, 163, 166, 175, 178, 265
Bme1390I CCNGG 2 cut(s) 260, 299
BmgT120I GGNCC 1 cut(s) 26
BmrFI CCNGG 2 cut(s) 260, 299
BpiI GAAGAC 1 cut(s) 53
BpuEI CTTGAG 1 cut(s) 66
BsaJI CCNNGG 2 cut(s) 141, 147
BsaWI WCCGGW 1 cut(s) 288
Bsc4I CCNNNNNNNGG 1 cut(s) 259
Bse1I ACTGG 1 cut(s) 233
Bse3DI GCAATG 1 cut(s) 407
BseAI TCCGGA 1 cut(s) 288
BseBI CCWGG 2 cut(s) 260, 299
BseDI CCNNGG 2 cut(s) 141, 147
BseLI CCNNNNNNNGG 1 cut(s) 259
BseMI GCAATG 1 cut(s) 407
BseNI ACTGG 1 cut(s) 233
BseXI GCAGC 4 cut(s) 140, 160, 164, 188
Bsh1236I CGCG 1 cut(s) 161
BshFI GGCC 3 cut(s) 27, 146, 263
BsiSI CCGG 2 cut(s) 13, 289
BslI CCNNNNNNNGG 1 cut(s) 259
BsmAI GTCTC 1 cut(s) 203
BsnI GGCC 3 cut(s) 27, 146, 263
Bsp13I TCCGGA 1 cut(s) 288
BspACI CCGC 8 cut(s) 119, 125, 138, 161, 164, 179, 253, 264
BspANI GGCC 3 cut(s) 27, 146, 263
BspEI TCCGGA 1 cut(s) 288
BspFNI CGCG 1 cut(s) 161
BspMAI CTGCAG 1 cut(s) 178
BsrDI GCAATG 1 cut(s) 407
BsrI ACTGG 1 cut(s) 233
BssECI CCNNGG 2 cut(s) 141, 147
Bst2UI CCWGG 2 cut(s) 260, 299
Bst4CI ACNGT 1 cut(s) 279
Bst6I CTCTTC 1 cut(s) 26
BstAPI GCANNNNNTGC 1 cut(s) 134
BstC8I GCNNGC 2 cut(s) 111, 230
BstDSI CCRYGG 1 cut(s) 141
BstFNI CGCG 1 cut(s) 161
BstMAI GTCTC 1 cut(s) 203
BstNI CCWGG 2 cut(s) 260, 299
BstSCI CCNGG 2 cut(s) 258, 297
BstSFI CTRYAG 1 cut(s) 174
BstUI CGCG 1 cut(s) 161
BstV1I GCAGC 4 cut(s) 140, 160, 164, 188
BstV2I GAAGAC 1 cut(s) 53
BsuRI GGCC 3 cut(s) 27, 146, 263
BtgI CCRYGG 1 cut(s) 141
Cac8I GCNNGC 2 cut(s) 111, 230
CaiI CAGNNNCTG 2 cut(s) 134, 314
Cfr13I GGNCC 1 cut(s) 26
CsiI ACCWGGT 1 cut(s) 297
Csp6I GTAC 1 cut(s) 370
CspCI CAANNNNNGTGG 2 cut(s) 102, 137
CviAII CATG 2 cut(s) 170, 382
CviQI GTAC 1 cut(s) 370
DrdI GACNNNNNNGTC 1 cut(s) 428
DseDI GACNNNNNNGTC 1 cut(s) 428
EaeI YGGCCR 2 cut(s) 144, 261
Eam1104I CTCTTC 1 cut(s) 26
EarI CTCTTC 1 cut(s) 26
Eco57I CTGAAG 1 cut(s) 57
EcoRII CCWGG 2 cut(s) 258, 297
FaeI CATG 2 cut(s) 173, 385
FaiI YATR 2 cut(s) 171, 383
FatI CATG 2 cut(s) 169, 381
Fnu4HI GCNGC 9 cut(s) 126, 129, 138, 153, 162, 165, 174, 177, 264
Fsp4HI GCNGC 9 cut(s) 126, 129, 138, 153, 162, 165, 174, 177, 264
GluI GCNGC 9 cut(s) 126, 129, 138, 153, 162, 165, 174, 177, 264
HaeIII GGCC 3 cut(s) 27, 146, 263
HapII CCGG 2 cut(s) 13, 289
Hin1II CATG 2 cut(s) 173, 385
HinfI GANTC 5 cut(s) 18, 98, 240, 311, 338
HpaII CCGG 2 cut(s) 13, 289
HphI GGTGA 1 cut(s) 242
Hpy188I TCNGA 1 cut(s) 310
Hpy188III TCNNGA 3 cut(s) 83, 289, 377
HpyAV CCTTC 3 cut(s) 351, 405, 412
HpyCH4III ACNGT 1 cut(s) 279
HpyCH4IV ACGT 1 cut(s) 222
HpyCH4V TGCA 3 cut(s) 176, 412, 439
HpySE526I ACGT 1 cut(s) 222
Hsp92II CATG 2 cut(s) 173, 385
Kpn2I TCCGGA 1 cut(s) 288
Lsp1109I GCAGC 4 cut(s) 140, 160, 164, 188
MabI ACCWGGT 1 cut(s) 297
MaeII ACGT 1 cut(s) 222
MaeIII GTNAC 2 cut(s) 248, 360
MboII GAAGA 3 cut(s) 13, 58, 333
MluCI AATT 2 cut(s) 325, 433
MlyI GAGTC 4 cut(s) 12, 92, 249, 320
MmeI TCCRAC 2 cut(s) 126, 415
MnlI CCTC 4 cut(s) 76, 142, 175, 408
MroI TCCGGA 1 cut(s) 288
MroXI GAANNNNTTC 1 cut(s) 325
MseI TTAA 1 cut(s) 270
MspA1I CMGCKG 1 cut(s) 179
MspI CCGG 2 cut(s) 13, 289
MspR9I CCNGG 2 cut(s) 260, 299
MvaI CCWGG 2 cut(s) 260, 299
MvnI CGCG 1 cut(s) 161
NlaIII CATG 2 cut(s) 173, 385
NmeAIII GCCGAG 1 cut(s) 172
NmuCI GTSAC 1 cut(s) 248
PdmI GAANNNNTTC 1 cut(s) 325
PfeI GAWTC 1 cut(s) 338
PkrI GCNGC 9 cut(s) 127, 130, 139, 154, 163, 166, 175, 178, 265
PleI GAGTC 4 cut(s) 12, 92, 248, 319
PpsI GAGTC 4 cut(s) 12, 92, 248, 319
Psp1406I AACGTT 1 cut(s) 222
Psp6I CCWGG 2 cut(s) 258, 297
PspGI CCWGG 2 cut(s) 258, 297
PspPI GGNCC 1 cut(s) 26
PstI CTGCAG 1 cut(s) 178
PstNI CAGNNNCTG 2 cut(s) 134, 314
RsaI GTAC 1 cut(s) 371
RsaNI GTAC 1 cut(s) 370
SaqAI TTAA 1 cut(s) 270
SatI GCNGC 9 cut(s) 126, 129, 138, 153, 162, 165, 174, 177, 264
Sau96I GGNCC 1 cut(s) 26
SchI GAGTC 4 cut(s) 12, 92, 249, 320
ScrFI CCNGG 2 cut(s) 260, 299
SexAI ACCWGGT 1 cut(s) 297
SfcI CTRYAG 1 cut(s) 174
SmlI CTYRAG 1 cut(s) 81
SmoI CTYRAG 1 cut(s) 81
Sse9I AATT 2 cut(s) 325, 433
SsiI CCGC 8 cut(s) 119, 125, 138, 161, 164, 179, 253, 264
StyD4I CCNGG 2 cut(s) 258, 297
TaaI ACNGT 1 cut(s) 279
TaiI ACGT 1 cut(s) 225
TasI AATT 2 cut(s) 325, 433
TauI GCSGC 5 cut(s) 128, 140, 164, 167, 266
TfiI GAWTC 1 cut(s) 338
Tru1I TTAA 1 cut(s) 270
Tru9I TTAA 1 cut(s) 270
TseFI GTSAC 1 cut(s) 248
TseI GCWGC 4 cut(s) 128, 152, 173, 176
Tsp45I GTSAC 1 cut(s) 248
XapI RAATTY 1 cut(s) 325
XmnI GAANNNNTTC 1 cut(s) 325
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.