Rmu_sc0002177.1_g000017

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002177.1
Physical Location & Seq
Reverse (-)
82159 .. 82455
297 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002177.1_g000017.1.cds

Sequence Viewer

Length: 297 bp
atgagtgttgtggcagcagcagctggtaatgctgctatatgtcaggatttgttatggacagtacaaaatgaagtggagattgaggataatatatacactgtgaaagcagcatgtgagaggtatattgatgagtggaagagaaagaagaaacaggaaaataaggatgaacatttcccttcaactattgggctctatagctgtgaagggcagcaggctgttataatatttgttggattccgcaaccaaatggcaacaaagttgggaagagtcatggcatgtggggctggtagtagctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

98

Amino Acids

10.85

Weight (kDa)

5.77

Isoelectric Point (pI)

53.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016243)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 221
AciI CCGC 1 cut(s) 238
AfaI GTAC 1 cut(s) 63
AgsI TTSAA 1 cut(s) 180
AluBI AGCT 3 cut(s) 23, 198, 294
AluI AGCT 3 cut(s) 23, 198, 294
AlwNI CAGNNNCTG 1 cut(s) 23
ApeKI GCWGC 6 cut(s) 14, 17, 20, 32, 107, 208
BanII GRGCYC 1 cut(s) 192
BbvI GCAGC 6 cut(s) 19, 26, 29, 32, 119, 220
BfaI CTAG 1 cut(s) 295
BfmI CTRYAG 1 cut(s) 193
BisI GCNGC 6 cut(s) 15, 18, 21, 33, 108, 209
BlsI GCNGC 6 cut(s) 16, 19, 22, 34, 109, 210
BseGI GGATG 1 cut(s) 169
BseXI GCAGC 6 cut(s) 19, 26, 29, 32, 119, 220
Bsp1286I GDGCHC 1 cut(s) 192
BspACI CCGC 1 cut(s) 238
Bst4CI ACNGT 2 cut(s) 61, 100
Bst6I CTCTTC 2 cut(s) 131, 259
BstC8I GCNNGC 1 cut(s) 213
BstF5I GGATG 1 cut(s) 169
BstMWI GCNNNNNNNGC 3 cut(s) 20, 29, 281
BstNSI RCATGY 2 cut(s) 114, 279
BstSFI CTRYAG 1 cut(s) 193
BstV1I GCAGC 6 cut(s) 19, 26, 29, 32, 119, 220
BtsCI GGATG 1 cut(s) 169
BtsIMutI CAGTG 1 cut(s) 96
Cac8I GCNNGC 1 cut(s) 213
CaiI CAGNNNCTG 1 cut(s) 23
Csp6I GTAC 1 cut(s) 62
CviAII CATG 3 cut(s) 111, 271, 276
CviJI RGCY 6 cut(s) 23, 190, 198, 215, 284, 294
CviKI_1 RGCY 6 cut(s) 23, 190, 198, 215, 284, 294
CviQI GTAC 1 cut(s) 62
Eam1104I CTCTTC 2 cut(s) 131, 259
EarI CTCTTC 2 cut(s) 131, 259
Eco24I GRGCYC 1 cut(s) 192
EcoT38I GRGCYC 1 cut(s) 192
FaeI CATG 3 cut(s) 114, 274, 279
FatI CATG 3 cut(s) 110, 270, 275
Fnu4HI GCNGC 6 cut(s) 15, 18, 21, 33, 108, 209
FokI GGATG 1 cut(s) 176
FriOI GRGCYC 1 cut(s) 192
Fsp4HI GCNGC 6 cut(s) 15, 18, 21, 33, 108, 209
FspBI CTAG 1 cut(s) 295
GluI GCNGC 6 cut(s) 15, 18, 21, 33, 108, 209
Hin1II CATG 3 cut(s) 114, 274, 279
HinfI GANTC 2 cut(s) 234, 267
Hpy188III TCNNGA 1 cut(s) 44
HpyAV CCTTC 2 cut(s) 186, 197
HpyCH4III ACNGT 2 cut(s) 61, 100
HpyF10VI GCNNNNNNNGC 3 cut(s) 20, 29, 281
Hsp92II CATG 3 cut(s) 114, 274, 279
LpnPI CCDG 5 cut(s) 9, 29, 137, 197, 270
Lsp1109I GCAGC 6 cut(s) 19, 26, 29, 32, 119, 220
MaeI CTAG 1 cut(s) 295
MboII GAAGA 3 cut(s) 148, 157, 276
MhlI GDGCHC 1 cut(s) 192
MlyI GAGTC 1 cut(s) 276
MmeI TCCRAC 1 cut(s) 211
MnlI CCTC 2 cut(s) 76, 111
MspA1I CMGCKG 1 cut(s) 23
MwoI GCNNNNNNNGC 3 cut(s) 20, 29, 281
NlaIII CATG 3 cut(s) 114, 274, 279
NspI RCATGY 2 cut(s) 114, 279
PfeI GAWTC 1 cut(s) 234
PkrI GCNGC 6 cut(s) 16, 19, 22, 34, 109, 210
PleI GAGTC 1 cut(s) 275
PpsI GAGTC 1 cut(s) 275
PsiI TTATAA 1 cut(s) 221
PstNI CAGNNNCTG 1 cut(s) 23
PvuII CAGCTG 1 cut(s) 23
RsaI GTAC 1 cut(s) 63
RsaNI GTAC 1 cut(s) 62
SatI GCNGC 6 cut(s) 15, 18, 21, 33, 108, 209
SchI GAGTC 1 cut(s) 276
SduI GDGCHC 1 cut(s) 192
SetI ASST 4 cut(s) 25, 122, 200, 296
SfcI CTRYAG 1 cut(s) 193
SgeI CNNG 7 cut(s) 36, 56, 123, 164, 224, 283, 288
SsiI CCGC 1 cut(s) 238
SspI AATATT 1 cut(s) 225
SspMI CTAG 1 cut(s) 295
TaaI ACNGT 2 cut(s) 61, 100
TatI WGTACW 1 cut(s) 61
TfiI GAWTC 1 cut(s) 234
TscAI CASTG 1 cut(s) 103
TseI GCWGC 6 cut(s) 14, 17, 20, 32, 107, 208
TspDTI ATGAA 2 cut(s) 84, 180
TspRI CASTG 1 cut(s) 103
XceI RCATGY 2 cut(s) 114, 279
XspI CTAG 1 cut(s) 295
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.