Rmu_sc0006730.1_g000003

protein At4g18490 isoform X1

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006730.1
Physical Location & Seq
Reverse (-)
10952 .. 13201
2250 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006730.1_g000003.1.cds

Sequence Viewer

Length: 951 bp
atggatttcaatctagttgggaacttacagctgtctaacaaagaagtaacagaaagggaacctatcggagtaagtgagcagggaaaattcttaaagattgtacaagtgagtccttccagctcaactgagaagacaagactacctagtattcagagtataaatcctaagctcagtctcccaagtgtgcagctactgagtaactcaaagaaaaccatctctacccggaaagtttccaactgtagacttcgtagaccttgcatggtgaatgtcatggaacttgaaattccttcagcaaaggaaactgatggaaatgctgaaaaggctgaagcatataccaaggcgtttaaagcagcattaccagctgctgctgccacaacacaaaaaatctatgaactcaatgagcgtgttgtggcagcagcagctggtaatgctgctatatgtcaggatttgttatggatggtacaaaatgaagtggagattgaggataatatatacactgtgaaagcagcatgtgagaggtatattgatgagtgcaagagaaagaagaaacaggaaaataaggatgaacatttcccttcaactattgggctctatagctgggaagggcagcaggctgttataatatttgttggattccgcaaccaaatggcaacagagttgggaatagtcatggcatgtggggctggtagtagctgggctgaaaactatctgggttcacagacgtggagagatgattttaccaagtttgattttgttcaccttgtcaagcaatcagtcacactttccagtttgcatagtccttctacgggtggtaggattacagtgctaagattgtctcgtggaggtgacagggaaatatttcccatgcatgatcatgtcatcaaatgcttgggtgactttttctatttcttttttctgtttaaggctctatgtaaccaaaaaggaaaataa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

316

Amino Acids

35.35

Weight (kDa)

8.68

Isoelectric Point (pI)

45.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0016243)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 620
AccI GTMKAC 2 cut(s) 241, 250
AciI CCGC 1 cut(s) 637
AcsI RAATTY 2 cut(s) 86, 282
AcuI CTGAAG 2 cut(s) 273, 345
AfaI GTAC 2 cut(s) 102, 462
AfiI CCNNNNNNNGG 1 cut(s) 806
AgsI TTSAA 3 cut(s) 10, 281, 579
AjiI CACGTC 1 cut(s) 723
AleI CACNNNNGTG 1 cut(s) 721
AluBI AGCT 8 cut(s) 31, 120, 169, 190, 362, 422, 597, 693
AluI AGCT 8 cut(s) 31, 120, 169, 190, 362, 422, 597, 693
Alw26I GTCTC 2 cut(s) 179, 840
AlwNI CAGNNNCTG 3 cut(s) 193, 365, 422
ApoI RAATTY 2 cut(s) 86, 282
Asp700I GAANNNNTTC 1 cut(s) 858
AsuC2I CCSGG 1 cut(s) 223
AsuHPI GGTGA 4 cut(s) 274, 749, 857, 905
BanII GRGCYC 1 cut(s) 591
BauI CACGAG 1 cut(s) 837
BbsI GAAGAC 1 cut(s) 137
BccI CCATC 3 cut(s) 221, 299, 451
BclI TGATCA 1 cut(s) 871
BcnI CCSGG 1 cut(s) 223
BcoDI GTCTC 2 cut(s) 179, 840
BfaI CTAG 2 cut(s) 14, 144
BfmI CTRYAG 2 cut(s) 238, 592
Bme1390I CCNGG 1 cut(s) 223
BmgBI CACGTC 1 cut(s) 723
BmiI GGNNCC 1 cut(s) 60
BmrFI CCNGG 1 cut(s) 223
BpiI GAAGAC 1 cut(s) 137
Bpu10I CCTNAGC 1 cut(s) 165
BpuMI CCSGG 1 cut(s) 223
BsaBI GATNNNNATC 1 cut(s) 9
BsaJI CCNNGG 1 cut(s) 336
Bsc4I CCNNNNNNNGG 1 cut(s) 806
Bse1I ACTGG 1 cut(s) 786
Bse8I GATNNNNATC 1 cut(s) 9
BseDI CCNNGG 1 cut(s) 336
BseGI GGATG 2 cut(s) 462, 568
BseJI GATNNNNATC 1 cut(s) 9
BseLI CCNNNNNNNGG 1 cut(s) 806
BseMII CTCAG 3 cut(s) 117, 184, 185
BseNI ACTGG 1 cut(s) 786
BseYI CCCAGC 2 cut(s) 597, 693
BsgI GTGCAG 1 cut(s) 206
BsiSI CCGG 1 cut(s) 223
BslI CCNNNNNNNGG 1 cut(s) 806
BsmAI GTCTC 2 cut(s) 179, 840
Bsp1286I GDGCHC 1 cut(s) 591
Bsp1407I TGTACA 1 cut(s) 100
Bsp143I GATC 1 cut(s) 871
BspACI CCGC 1 cut(s) 637
BspCNI CTCAG 3 cut(s) 118, 183, 186
BspLI GGNNCC 1 cut(s) 60
BsrGI TGTACA 1 cut(s) 100
BsrI ACTGG 1 cut(s) 786
BssECI CCNNGG 1 cut(s) 336
BssMI GATC 1 cut(s) 871
BssSI CACGAG 1 cut(s) 837
BssT1I CCWWGG 1 cut(s) 336
Bst2BI CACGAG 1 cut(s) 837
Bst4CI ACNGT 3 cut(s) 239, 499, 823
BstAUI TGTACA 1 cut(s) 100
BstC8I GCNNGC 1 cut(s) 612
BstDEI CTNAG 5 cut(s) 126, 165, 170, 194, 827
BstF5I GGATG 2 cut(s) 462, 568
BstKTI GATC 1 cut(s) 874
BstMAI GTCTC 2 cut(s) 179, 840
BstMBI GATC 1 cut(s) 871
BstMWI GCNNNNNNNGC 7 cut(s) 320, 347, 359, 368, 419, 428, 680
BstNSI RCATGY 2 cut(s) 513, 678
BstSCI CCNGG 1 cut(s) 221
BstSFI CTRYAG 2 cut(s) 238, 592
BstV2I GAAGAC 1 cut(s) 137
BtrI CACGTC 1 cut(s) 723
BtsCI GGATG 2 cut(s) 462, 568
BtsIMutI CAGTG 2 cut(s) 495, 828
Cac8I GCNNGC 1 cut(s) 612
CaiI CAGNNNCTG 3 cut(s) 193, 365, 422
Csp6I GTAC 2 cut(s) 101, 461
CviAII CATG 8 cut(s) 259, 271, 510, 670, 675, 865, 869, 875
CviQI GTAC 2 cut(s) 101, 461
DdeI CTNAG 5 cut(s) 126, 165, 170, 194, 827
DpnI GATC 1 cut(s) 873
DpnII GATC 1 cut(s) 871
DraI TTTAAA 1 cut(s) 346
Eco130I CCWWGG 1 cut(s) 336
Eco24I GRGCYC 1 cut(s) 591
Eco57I CTGAAG 2 cut(s) 273, 345
EcoT14I CCWWGG 1 cut(s) 336
EcoT22I ATGCAT 1 cut(s) 870
EcoT38I GRGCYC 1 cut(s) 591
ErhI CCWWGG 1 cut(s) 336
FaeI CATG 8 cut(s) 262, 274, 513, 673, 678, 868, 872, 878
FatI CATG 8 cut(s) 258, 270, 509, 669, 674, 864, 868, 874
FbaI TGATCA 1 cut(s) 871
FblI GTMKAC 2 cut(s) 241, 250
FokI GGATG 2 cut(s) 469, 575
FriOI GRGCYC 1 cut(s) 591
FspBI CTAG 2 cut(s) 14, 144
GsaI CCCAGC 2 cut(s) 601, 697
HapII CCGG 1 cut(s) 223
Hin1II CATG 8 cut(s) 262, 274, 513, 673, 678, 868, 872, 878
HinfI GANTC 2 cut(s) 109, 633
HpaII CCGG 1 cut(s) 223
HphI GGTGA 4 cut(s) 274, 749, 857, 905
Hpy166II GTNNAC 4 cut(s) 242, 251, 716, 757
Hpy188I TCNGA 2 cut(s) 68, 153
Hpy188III TCNNGA 1 cut(s) 443
Hpy8I GTNNAC 4 cut(s) 242, 251, 716, 757
HpyAV CCTTC 5 cut(s) 123, 297, 585, 596, 810
HpyCH4III ACNGT 3 cut(s) 239, 499, 823
HpyCH4IV ACGT 1 cut(s) 722
HpyCH4V TGCA 5 cut(s) 187, 258, 534, 793, 868
HpyF10VI GCNNNNNNNGC 7 cut(s) 320, 347, 359, 368, 419, 428, 680
HpyF3I CTNAG 5 cut(s) 126, 165, 170, 194, 827
HpySE526I ACGT 1 cut(s) 722
Hsp92II CATG 8 cut(s) 262, 274, 513, 673, 678, 868, 872, 878
Ksp22I TGATCA 1 cut(s) 871
Kzo9I GATC 1 cut(s) 871
MaeI CTAG 2 cut(s) 14, 144
MaeII ACGT 1 cut(s) 722
MaeIII GTNAC 6 cut(s) 46, 197, 775, 845, 893, 932
MalI GATC 1 cut(s) 873
MboI GATC 1 cut(s) 871
MboII GAAGA 2 cut(s) 142, 556
MhlI GDGCHC 1 cut(s) 591
MluCI AATT 2 cut(s) 86, 282
MlyI GAGTC 1 cut(s) 118
MmeI TCCRAC 2 cut(s) 258, 610
MnlI CCTC 3 cut(s) 475, 510, 836
Mph1103I ATGCAT 1 cut(s) 870
MroXI GAANNNNTTC 1 cut(s) 858
MseI TTAA 3 cut(s) 92, 345, 921
MslI CAYNNNNRTG 2 cut(s) 721, 873
MspA1I CMGCKG 3 cut(s) 31, 362, 422
MspI CCGG 1 cut(s) 223
MspR9I CCNGG 1 cut(s) 223
MwoI GCNNNNNNNGC 7 cut(s) 320, 347, 359, 368, 419, 428, 680
NciI CCSGG 1 cut(s) 223
NdeII GATC 1 cut(s) 871
NlaIII CATG 8 cut(s) 262, 274, 513, 673, 678, 868, 872, 878
NlaIV GGNNCC 1 cut(s) 60
NmuCI GTSAC 3 cut(s) 775, 845, 893
NsiI ATGCAT 1 cut(s) 870
NspI RCATGY 2 cut(s) 513, 678
OliI CACNNNNGTG 1 cut(s) 721
PdmI GAANNNNTTC 1 cut(s) 858
PfeI GAWTC 1 cut(s) 633
PleI GAGTC 1 cut(s) 117
PpsI GAGTC 1 cut(s) 117
PsiI TTATAA 1 cut(s) 620
PspFI CCCAGC 2 cut(s) 597, 693
PspN4I GGNNCC 1 cut(s) 60
PstNI CAGNNNCTG 3 cut(s) 193, 365, 422
PvuII CAGCTG 3 cut(s) 31, 362, 422
RsaI GTAC 2 cut(s) 102, 462
RsaNI GTAC 2 cut(s) 101, 461
RseI CAYNNNNRTG 2 cut(s) 721, 873
SaqAI TTAA 3 cut(s) 92, 345, 921
Sau3AI GATC 1 cut(s) 871
SchI GAGTC 1 cut(s) 118
ScrFI CCNGG 1 cut(s) 223
SduI GDGCHC 1 cut(s) 591
SfcI CTRYAG 2 cut(s) 238, 592
SmiMI CAYNNNNRTG 2 cut(s) 721, 873
Sse9I AATT 2 cut(s) 86, 282
SsiI CCGC 1 cut(s) 637
SspI AATATT 2 cut(s) 624, 858
SspMI CTAG 2 cut(s) 14, 144
StyD4I CCNGG 1 cut(s) 221
StyI CCWWGG 1 cut(s) 336
TaaI ACNGT 3 cut(s) 239, 499, 823
TaiI ACGT 1 cut(s) 725
TasI AATT 2 cut(s) 86, 282
TatI WGTACW 1 cut(s) 100
TfiI GAWTC 1 cut(s) 633
Tru1I TTAA 3 cut(s) 92, 345, 921
Tru9I TTAA 3 cut(s) 92, 345, 921
TscAI CASTG 2 cut(s) 502, 828
TseFI GTSAC 3 cut(s) 775, 845, 893
Tsp45I GTSAC 3 cut(s) 775, 845, 893
TspDTI ATGAA 3 cut(s) 405, 483, 579
TspRI CASTG 2 cut(s) 502, 828
XapI RAATTY 2 cut(s) 86, 282
XceI RCATGY 2 cut(s) 513, 678
XmiI GTMKAC 2 cut(s) 241, 250
XmnI GAANNNNTTC 1 cut(s) 858
XspI CTAG 2 cut(s) 14, 144
Zsp2I ATGCAT 1 cut(s) 870
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.