Rmu_sc0002247.1_g000021

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002247.1
OG0011980
Physical Location & Seq
Reverse (-)
116514 .. 116750
237 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002247.1_g000021.1.cds

Sequence Viewer

Length: 237 bp
atgatcaatctcaagtttgcagaggcaagggaggagatagagatggccatggagtccaaagagaccgtctattttgatgaggaggctgcttgtgctcggactgctgtcaatgaagttctcgatagctatgaagctttgttggcgaagttgacggaagacaaaagggctgcactgcagaggtctatgggcctcaagattgagcagttgaaagctgaaatcgaacagctgaatgaatga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

78

Amino Acids

8.91

Weight (kDa)

4.55

Isoelectric Point (pI)

69.21

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0011980)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G71730
fragaria_vesca FvH4_2g12890 FvH4_2g12890
malus_domestica MD05G1035400.v1.1 MD10G1037700.v1.1
prunus_persica Prupe.8G043100_v2.0.a1 Prupe.8G043100_v2.0.a1
pyrus_communis pycom10g02560
rosa_chinensis RchiOBHm_Chr6g0273991
rosa_laevigata RLG00000013586
rosa_multiflora Rmu_sc0000045.1_g000087 Rmu_sc0002247.1_g000021
rosa_roxburghii Rroxscaffold_7G00194810
rosa_rugosa Rorug06G0078100
rosa_samantha Rh6AG193700 Rh6BG197300 Rh6CG197200 Rh6DG189100
rosa_wichuraiana Rw6G016890

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 45
AgsI TTSAA 1 cut(s) 208
AluBI AGCT 4 cut(s) 126, 134, 212, 226
AluI AGCT 4 cut(s) 126, 134, 212, 226
Alw21I GWGCWC 1 cut(s) 97
Alw26I GTCTC 1 cut(s) 56
AoxI GGCC 2 cut(s) 45, 187
ApeKI GCWGC 2 cut(s) 86, 167
ArsI GACNNNNNNTTYG 2 cut(s) 51, 83
AspS9I GGNCC 1 cut(s) 187
BalI TGGCCA 1 cut(s) 47
BbsI GAAGAC 1 cut(s) 162
Bbv12I GWGCWC 1 cut(s) 97
BbvI GCAGC 2 cut(s) 73, 154
BccI CCATC 1 cut(s) 37
BclI TGATCA 1 cut(s) 3
BcoDI GTCTC 1 cut(s) 56
BfmI CTRYAG 1 cut(s) 173
BisI GCNGC 2 cut(s) 87, 168
BlsI GCNGC 2 cut(s) 88, 169
BmgT120I GGNCC 1 cut(s) 187
BoxI GACNNNNGTC 1 cut(s) 104
BpiI GAAGAC 1 cut(s) 162
BpuEI CTTGAG 1 cut(s) 176
BsaI GGTCTC 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 48
BseDI CCNNGG 1 cut(s) 48
BseRI GAGGAG 2 cut(s) 47, 95
BseXI GCAGC 2 cut(s) 73, 154
BsgI GTGCAG 1 cut(s) 153
BshFI GGCC 2 cut(s) 47, 189
BsiHKAI GWGCWC 1 cut(s) 97
BsmAI GTCTC 1 cut(s) 56
BsnI GGCC 2 cut(s) 47, 189
Bso31I GGTCTC 1 cut(s) 56
Bsp1286I GDGCHC 1 cut(s) 97
Bsp143I GATC 1 cut(s) 3
Bsp19I CCATGG 1 cut(s) 48
BspANI GGCC 2 cut(s) 47, 189
BspMAI CTGCAG 1 cut(s) 177
BspTNI GGTCTC 1 cut(s) 56
BssECI CCNNGG 1 cut(s) 48
BssMI GATC 1 cut(s) 3
BssT1I CCWWGG 1 cut(s) 48
Bst4CI ACNGT 1 cut(s) 67
BstDSI CCRYGG 1 cut(s) 48
BstKTI GATC 1 cut(s) 6
BstMAI GTCTC 1 cut(s) 56
BstMBI GATC 1 cut(s) 3
BstMWI GCNNNNNNNGC 3 cut(s) 92, 101, 140
BstPAI GACNNNNGTC 1 cut(s) 104
BstSFI CTRYAG 1 cut(s) 173
BstV1I GCAGC 2 cut(s) 73, 154
BstV2I GAAGAC 1 cut(s) 162
BsuRI GGCC 2 cut(s) 47, 189
BtgI CCRYGG 1 cut(s) 48
BtsI GCAGTG 1 cut(s) 170
BtsIMutI CAGTG 1 cut(s) 170
Cfr13I GGNCC 1 cut(s) 187
CviAII CATG 1 cut(s) 49
CviJI RGCY 8 cut(s) 47, 86, 126, 134, 167, 189, 212, 226
CviKI_1 RGCY 8 cut(s) 47, 86, 126, 134, 167, 189, 212, 226
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
EaeI YGGCCR 1 cut(s) 45
Eco130I CCWWGG 1 cut(s) 48
Eco31I GGTCTC 1 cut(s) 56
EcoT14I CCWWGG 1 cut(s) 48
ErhI CCWWGG 1 cut(s) 48
FaeI CATG 1 cut(s) 52
FaiI YATR 3 cut(s) 50, 129, 185
FatI CATG 1 cut(s) 48
FbaI TGATCA 1 cut(s) 3
Fnu4HI GCNGC 2 cut(s) 87, 168
Fsp4HI GCNGC 2 cut(s) 87, 168
GluI GCNGC 2 cut(s) 87, 168
HaeIII GGCC 2 cut(s) 47, 189
Hin1II CATG 1 cut(s) 52
HincII GTYRAC 1 cut(s) 150
HindII GTYRAC 1 cut(s) 150
HindIII AAGCTT 1 cut(s) 132
HinfI GANTC 1 cut(s) 53
Hpy166II GTNNAC 1 cut(s) 150
Hpy188I TCNGA 1 cut(s) 99
Hpy188III TCNNGA 2 cut(s) 119, 193
Hpy8I GTNNAC 1 cut(s) 150
HpyCH4III ACNGT 1 cut(s) 67
HpyCH4V TGCA 3 cut(s) 20, 170, 175
HpyF10VI GCNNNNNNNGC 3 cut(s) 92, 101, 140
Hsp92II CATG 1 cut(s) 52
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
Lsp1109I GCAGC 2 cut(s) 73, 154
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 1 cut(s) 167
MhlI GDGCHC 1 cut(s) 97
MlsI TGGCCA 1 cut(s) 47
MluNI TGGCCA 1 cut(s) 47
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 6 cut(s) 16, 25, 73, 76, 171, 200
Mox20I TGGCCA 1 cut(s) 47
MscI TGGCCA 1 cut(s) 47
Msp20I TGGCCA 1 cut(s) 47
MspA1I CMGCKG 1 cut(s) 226
MwoI GCNNNNNNNGC 3 cut(s) 92, 101, 140
NcoI CCATGG 1 cut(s) 48
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 52
PkrI GCNGC 2 cut(s) 88, 169
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
PshAI GACNNNNGTC 1 cut(s) 104
PspPI GGNCC 1 cut(s) 187
PstI CTGCAG 1 cut(s) 177
PvuII CAGCTG 1 cut(s) 226
SatI GCNGC 2 cut(s) 87, 168
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 1 cut(s) 187
SchI GAGTC 1 cut(s) 62
SduI GDGCHC 1 cut(s) 97
SetI ASST 5 cut(s) 128, 136, 182, 214, 228
SfcI CTRYAG 1 cut(s) 173
SgeI CNNG 7 cut(s) 25, 39, 61, 102, 108, 131, 205
SmlI CTYRAG 2 cut(s) 11, 191
SmoI CTYRAG 2 cut(s) 11, 191
StyI CCWWGG 1 cut(s) 48
TaaI ACNGT 1 cut(s) 67
TaqI TCGA 2 cut(s) 120, 219
TscAI CASTG 1 cut(s) 177
TseI GCWGC 2 cut(s) 86, 167
TspDTI ATGAA 2 cut(s) 126, 144
TspGWI ACGGA 1 cut(s) 167
TspRI CASTG 1 cut(s) 177
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.