Rmu_sc0002324.1_g000010

Afadin- and alpha-actinin-binding

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002324.1
Physical Location & Seq
Forward (+)
35441 .. 41770
6330 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002324.1_g000010.1.cds

Sequence Viewer

Length: 1521 bp
atgtattctttgattcagcagagacaacgcgatgtagaatttcgagagtctgctaacgaacagagacagcggctattgtcagacatatcaaggttagaagctaaagttgagcggcttgaggggcatattcaagccaaagatagggaaatagcaacaatgacacgaacggaagctaaagctacagcggcttttaagtctcaaattgagaagctgcagaaagagcgagatgagtttcagagaatggtcattgggaatcagcaagttaagactcaacaaatgcatgagatgaagaaaaaagaaaaggagtacataaagctgcaggagagactaaaccaagtgttgatggagaaaaagaaggaatctagatctggcatggagataatgaacttgcttcagtccgcgttcgcaatcggagagtacgcatttgccgatgtggggaatttggagcactgtatcaagtatttgaaccagacgctcgttactttcggattcccggcttcgcttgatctcttcgccaatgatccggtttcggtagctcggacttgcaattgtatgtattctttgattcagcagagacaacgcgatgtagaatttcgagagtctgctaacgaacagagacagcggctattgtcagacatatcaaggttagaagctaaagttgagcggcttgaggggcatattcaagccaaagatagggaaatagcaacaatgacacgaacggaagctaaagctacagcggcttttaagtctcaaattgagaagctgcagaaagagcgagatgagtttcagagaatggtcattgggaatcagcaagttaagactcaacaaatgcatgagatgaagaaaaaagaaaaggagtacataaagctgcaggagagactaaaccaagtgttgatggagaaaaagaaggaatctagatctggcatggagataatgaacttgcttcagaaagaagggaggcagcagcgtggaacatggaacggaaagaagactgataatgatttttataaaaagattgtggatgcttatgaggccaaaaatcaagacttgatggcggagaattccgatctgaaggcattattacgatcaatgcagatggatatgcgtgatttcataaatcatccaaatgggcagtctaagcagtctctagctgccaatgaacaggttgaaactgaccacacacaatctccattgggtggaagaacggatgtctttgatctgccctttcacatggccagaaatcaaatagaagaaagtctccgaaataagatggcttcgataaaggagcgtatgggtcaattgcaagatgcacaaaaagaagcggaggttacttctgaagcaactgagagggagcttgagcttgaagctcaacttgttgaggcgaggagcataatccaagagcaggcgtccataatgtccaaacaatttaccaagcctgagaggcaaaggagtctgaatggctattttaattctggcagggaatctatgatttcgtcacctgcggagggggtaagaaactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

506

Amino Acids

58.98

Weight (kDa)

8.76

Isoelectric Point (pI)

48.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1008
AarI CACCTGC 1 cut(s) 1507
Acc36I ACCTGC 1 cut(s) 1507
AccB7I CCANNNNNTGG 1 cut(s) 1196
AccBSI CCGCTC 2 cut(s) 112, 664
AccII CGCG 3 cut(s) 30, 401, 582
AclWI GGATC 1 cut(s) 515
AcoI YGGCCR 1 cut(s) 1233
AcsI RAATTY 4 cut(s) 38, 439, 590, 1060
AcuI CTGAAG 4 cut(s) 377, 929, 1091, 1356
AcyI GRCGYC 1 cut(s) 1406
AfaI GTAC 3 cut(s) 308, 419, 860
AfiI CCNNNNNNNGG 6 cut(s) 141, 435, 693, 1196, 1402, 1505
AgsI TTSAA 5 cut(s) 131, 466, 683, 1169, 1364
Alw21I GWGCWC 1 cut(s) 450
AlwI GGATC 1 cut(s) 515
AoxI GGCC 2 cut(s) 1032, 1233
ApeKI GCWGC 7 cut(s) 211, 316, 763, 868, 961, 964, 1151
ApoI RAATTY 4 cut(s) 38, 439, 590, 1060
ArsI GACNNNNNNTTYG 2 cut(s) 1118, 1150
AsuC2I CCSGG 1 cut(s) 494
AsuHPI GGTGA 1 cut(s) 1488
BalI TGGCCA 1 cut(s) 1235
BbsI GAAGAC 1 cut(s) 995
Bbv12I GWGCWC 1 cut(s) 450
BbvI GCAGC 7 cut(s) 198, 303, 750, 855, 973, 976, 1138
BccI CCATC 5 cut(s) 337, 889, 1045, 1090, 1264
BcnI CCSGG 1 cut(s) 494
BfaI CTAG 3 cut(s) 363, 915, 1148
BfmI CTRYAG 6 cut(s) 180, 212, 317, 732, 764, 869
BfuAI ACCTGC 1 cut(s) 1507
BglI GCCNNNNNGGC 1 cut(s) 1441
BglII AGATCT 2 cut(s) 365, 917
Bme1390I CCNGG 1 cut(s) 494
BmrFI CCNGG 1 cut(s) 494
BmsI GCATC 2 cut(s) 1012, 1297
BpiI GAAGAC 1 cut(s) 995
BpuEI CTTGAG 3 cut(s) 137, 689, 1376
BpuMI CCSGG 1 cut(s) 494
BsaHI GRCGYC 1 cut(s) 1406
BsaWI WCCGGW 1 cut(s) 523
BsaXI ACNNNNNCTCC 2 cut(s) 1171, 1201
Bsc4I CCNNNNNNNGG 6 cut(s) 141, 435, 693, 1196, 1402, 1505
BseGI GGATG 3 cut(s) 1027, 1120, 1213
BseLI CCNNNNNNNGG 6 cut(s) 141, 435, 693, 1196, 1402, 1505
BseMII CTCAG 2 cut(s) 1335, 1428
BseRI GAGGAG 1 cut(s) 1399
BseXI GCAGC 7 cut(s) 198, 303, 750, 855, 973, 976, 1138
Bsh1236I CGCG 3 cut(s) 30, 401, 582
BshFI GGCC 2 cut(s) 1034, 1235
BsiHKAI GWGCWC 1 cut(s) 450
BsiSI CCGG 2 cut(s) 494, 524
BslI CCNNNNNNNGG 6 cut(s) 141, 435, 693, 1196, 1402, 1505
BsnI GGCC 2 cut(s) 1034, 1235
Bsp1286I GDGCHC 1 cut(s) 450
Bsp143I GATC 7 cut(s) 365, 505, 520, 917, 1066, 1085, 1216
BspANI GGCC 2 cut(s) 1034, 1235
BspCNI CTCAG 2 cut(s) 1336, 1429
BspFNI CGCG 3 cut(s) 30, 401, 582
BspMAI CTGCAG 4 cut(s) 216, 321, 768, 873
BspMI ACCTGC 1 cut(s) 1507
BspPI GGATC 1 cut(s) 515
BsrBI CCGCTC 2 cut(s) 112, 664
BssMI GATC 7 cut(s) 365, 505, 520, 917, 1066, 1085, 1216
BssNI GRCGYC 1 cut(s) 1406
Bst4CI ACNGT 1 cut(s) 452
Bst6I CTCTTC 1 cut(s) 515
BstACI GRCGYC 1 cut(s) 1406
BstC8I GCNNGC 1 cut(s) 1404
BstDEI CTNAG 3 cut(s) 1137, 1344, 1437
BstF5I GGATG 3 cut(s) 1027, 1120, 1213
BstFNI CGCG 3 cut(s) 30, 401, 582
BstKTI GATC 7 cut(s) 368, 508, 523, 920, 1069, 1088, 1219
BstMBI GATC 7 cut(s) 365, 505, 520, 917, 1066, 1085, 1216
BstMWI GCNNNNNNNGC 9 cut(s) 121, 185, 220, 673, 737, 772, 1031, 1138, 1441
BstSCI CCNGG 1 cut(s) 492
BstSFI CTRYAG 6 cut(s) 180, 212, 317, 732, 764, 869
BstUI CGCG 3 cut(s) 30, 401, 582
BstV1I GCAGC 7 cut(s) 198, 303, 750, 855, 973, 976, 1138
BstV2I GAAGAC 1 cut(s) 995
BstX2I RGATCY 2 cut(s) 365, 917
BstYI RGATCY 2 cut(s) 365, 917
BsuRI GGCC 2 cut(s) 1034, 1235
BtgZI GCGATG 2 cut(s) 45, 597
BtsCI GGATG 3 cut(s) 1027, 1120, 1213
BtsIMutI CAGTG 1 cut(s) 448
BveI ACCTGC 1 cut(s) 1507
Cac8I GCNNGC 1 cut(s) 1404
CseI GACGC 2 cut(s) 481, 1395
Csp6I GTAC 3 cut(s) 307, 418, 859
CviAII CATG 6 cut(s) 281, 373, 833, 925, 975, 1231
CviQI GTAC 3 cut(s) 307, 418, 859
DdeI CTNAG 3 cut(s) 1137, 1344, 1437
DpnI GATC 7 cut(s) 367, 507, 522, 919, 1068, 1087, 1218
DpnII GATC 7 cut(s) 365, 505, 520, 917, 1066, 1085, 1216
EaeI YGGCCR 1 cut(s) 1233
Eam1104I CTCTTC 1 cut(s) 515
EarI CTCTTC 1 cut(s) 515
EciI GGCGGA 1 cut(s) 1070
Eco57I CTGAAG 4 cut(s) 377, 929, 1091, 1356
EcoRI GAATTC 1 cut(s) 1060
EcoT22I ATGCAT 2 cut(s) 282, 834
FaeI CATG 6 cut(s) 284, 376, 836, 928, 978, 1234
FalI AAGNNNNNCTT 2 cut(s) 1356, 1388
FatI CATG 6 cut(s) 280, 372, 832, 924, 974, 1230
FokI GGATG 3 cut(s) 1034, 1107, 1220
FspBI CTAG 3 cut(s) 363, 915, 1148
HaeIII GGCC 2 cut(s) 1034, 1235
HapII CCGG 2 cut(s) 494, 524
HgaI GACGC 2 cut(s) 481, 1395
Hin1I GRCGYC 1 cut(s) 1406
Hin1II CATG 6 cut(s) 284, 376, 836, 928, 978, 1234
HpaII CCGG 2 cut(s) 494, 524
HphI GGTGA 1 cut(s) 1488
Hpy188III TCNNGA 5 cut(s) 44, 363, 596, 915, 1043
HpyAV CCTTC 4 cut(s) 349, 901, 947, 1066
HpyCH4III ACNGT 1 cut(s) 452
HpyF10VI GCNNNNNNNGC 9 cut(s) 121, 185, 220, 673, 737, 772, 1031, 1138, 1441
HpyF3I CTNAG 3 cut(s) 1137, 1344, 1437
Hsp92I GRCGYC 1 cut(s) 1406
Hsp92II CATG 6 cut(s) 284, 376, 836, 928, 978, 1234
Kzo9I GATC 7 cut(s) 365, 505, 520, 917, 1066, 1085, 1216
LmnI GCTCC 4 cut(s) 445, 1285, 1351, 1386
Lsp1109I GCAGC 7 cut(s) 198, 303, 750, 855, 973, 976, 1138
LweI GCATC 2 cut(s) 1012, 1297
MaeI CTAG 3 cut(s) 363, 915, 1148
MaeIII GTNAC 3 cut(s) 478, 1327, 1494
MalI GATC 7 cut(s) 367, 507, 522, 919, 1068, 1087, 1218
MbiI CCGCTC 2 cut(s) 112, 664
MboI GATC 7 cut(s) 365, 505, 520, 917, 1066, 1085, 1216
MboII GAAGA 6 cut(s) 301, 502, 853, 1000, 1212, 1262
MfeI CAATTG 2 cut(s) 547, 1298
MflI RGATCY 2 cut(s) 365, 917
MhlI GDGCHC 1 cut(s) 450
MlsI TGGCCA 1 cut(s) 1235
MluNI TGGCCA 1 cut(s) 1235
MlyI GAGTC 5 cut(s) 56, 262, 608, 814, 1459
Mox20I TGGCCA 1 cut(s) 1235
Mph1103I ATGCAT 2 cut(s) 282, 834
MscI TGGCCA 1 cut(s) 1235
MseI TTAA 5 cut(s) 192, 264, 744, 816, 1467
MslI CAYNNNNRTG 1 cut(s) 1125
Msp20I TGGCCA 1 cut(s) 1235
MspA1I CMGCKG 4 cut(s) 70, 185, 622, 737
MspI CCGG 2 cut(s) 494, 524
MspR9I CCNGG 1 cut(s) 494
MunI CAATTG 2 cut(s) 547, 1298
MvnI CGCG 3 cut(s) 30, 401, 582
MwoI GCNNNNNNNGC 9 cut(s) 121, 185, 220, 673, 737, 772, 1031, 1138, 1441
NciI CCSGG 1 cut(s) 494
NdeII GATC 7 cut(s) 365, 505, 520, 917, 1066, 1085, 1216
NlaIII CATG 6 cut(s) 284, 376, 836, 928, 978, 1234
NmuCI GTSAC 1 cut(s) 1494
NsiI ATGCAT 2 cut(s) 282, 834
PaqCI CACCTGC 1 cut(s) 1507
PcsI WCGNNNNNNNCGW 1 cut(s) 426
PfeI GAWTC 8 cut(s) 13, 253, 359, 489, 565, 805, 911, 1481
PflMI CCANNNNNTGG 1 cut(s) 1196
PleI GAGTC 5 cut(s) 55, 262, 607, 814, 1458
PpsI GAGTC 5 cut(s) 55, 262, 607, 814, 1458
PsiI TTATAA 1 cut(s) 1008
PstI CTGCAG 4 cut(s) 216, 321, 768, 873
PsuI RGATCY 2 cut(s) 365, 917
RsaI GTAC 3 cut(s) 308, 419, 860
RsaNI GTAC 3 cut(s) 307, 418, 859
RseI CAYNNNNRTG 1 cut(s) 1125
SaqAI TTAA 5 cut(s) 192, 264, 744, 816, 1467
Sau3AI GATC 7 cut(s) 365, 505, 520, 917, 1066, 1085, 1216
SchI GAGTC 5 cut(s) 56, 262, 608, 814, 1459
ScrFI CCNGG 1 cut(s) 494
SduI GDGCHC 1 cut(s) 450
SfaNI GCATC 2 cut(s) 1012, 1297
SfcI CTRYAG 6 cut(s) 180, 212, 317, 732, 764, 869
SmiMI CAYNNNNRTG 1 cut(s) 1125
SmlI CTYRAG 3 cut(s) 116, 668, 1355
SmoI CTYRAG 3 cut(s) 116, 668, 1355
SspMI CTAG 3 cut(s) 363, 915, 1148
StyD4I CCNGG 1 cut(s) 492
TaaI ACNGT 1 cut(s) 452
TaqI TCGA 3 cut(s) 43, 595, 1277
TatI WGTACW 2 cut(s) 306, 858
TauI GCSGC 6 cut(s) 73, 115, 188, 625, 667, 740
TfiI GAWTC 8 cut(s) 13, 253, 359, 489, 565, 805, 911, 1481
Tru1I TTAA 5 cut(s) 192, 264, 744, 816, 1467
Tru9I TTAA 5 cut(s) 192, 264, 744, 816, 1467
TscAI CASTG 1 cut(s) 455
TseFI GTSAC 1 cut(s) 1494
TseI GCWGC 7 cut(s) 211, 316, 763, 868, 961, 964, 1151
Tsp45I GTSAC 1 cut(s) 1494
TspDTI ATGAA 6 cut(s) 302, 398, 854, 950, 1102, 1173
TspGWI ACGGA 4 cut(s) 182, 734, 996, 1220
TspRI CASTG 1 cut(s) 455
Van91I CCANNNNNTGG 1 cut(s) 1196
XapI RAATTY 4 cut(s) 38, 439, 590, 1060
XbaI TCTAGA 2 cut(s) 362, 914
XspI CTAG 3 cut(s) 363, 915, 1148
Zsp2I ATGCAT 2 cut(s) 282, 834
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.