Rmu_sc0002327.1_g000028

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002327.1
Physical Location & Seq
Forward (+)
98242 .. 99042
801 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002327.1_g000028.1.cds

Sequence Viewer

Length: 801 bp
atgtgttcaaagacgtctaacgagaagctcagtcgtatagactgcccagattgggcaagtcttcacagatcccccgtctatttgtttctggacaagtttttggaacccattgatcttgttcgttttgctgcagtttgcaaggagtggcgtgcagtttcagaagattataatgaagcaaagcagcggtggtgtaaaagtaagctacttccgatgctcttgatcccatgtacttccgaagaaaagctagaactgtacagcattgctgaaagagaagtctacagcaatatcgagttaccattgccttgtagtaattctaggaggtgttttggctccaaccacgacagtggtggttggttgaccataggagatcaagtagagcgtgagttgccatatttagatataactctcacgaaccctttcagaaaagaagtggcacccattaaccttcctcatttgcaattcaaatatttatctcaagaaggacgttggcagcgcccgaaggttatattatccggtgatcccacattgaacccggacagttttgtggttttaacaatcaatagtcaattgcaaaatggacaccaggtgtcttccattaagggactaaatagtgattgggttcattgggactttgcttataacgttactgatgccatagtttatagaagccagatctacttggttactgttgatagatggctcgctttgttggatgttgaccaggcaataacaaacatattccttccgcctcaacaaattcttccgccagctaaggtgtatcttgtagaatcaacacggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

266

Amino Acids

30.67

Weight (kDa)

5.78

Isoelectric Point (pI)

46.64

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018028)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 2 cut(s) 168, 639
AatII GACGTC 1 cut(s) 17
AccB1I GGYRCC 1 cut(s) 433
AccI GTMKAC 1 cut(s) 276
AciI CCGC 3 cut(s) 184, 746, 764
AclI AACGTT 1 cut(s) 642
AclWI GGATC 3 cut(s) 63, 214, 512
AcsI RAATTY 1 cut(s) 756
AcyI GRCGYC 1 cut(s) 14
AdeI CACNNNGTG 1 cut(s) 586
AfaI GTAC 2 cut(s) 229, 254
AfiI CCNNNNNNNGG 1 cut(s) 52
AgsI TTSAA 3 cut(s) 9, 463, 529
AjnI CCWGG 2 cut(s) 582, 720
AleI CACNNNNGTG 1 cut(s) 342
AluBI AGCT 4 cut(s) 28, 202, 244, 770
AluI AGCT 4 cut(s) 28, 202, 244, 770
AlwI GGATC 3 cut(s) 63, 214, 512
ApeKI GCWGC 3 cut(s) 128, 181, 490
ApoI RAATTY 1 cut(s) 756
Asp700I GAANNNNTTC 1 cut(s) 416
AspLEI GCGC 1 cut(s) 495
AsuC2I CCSGG 1 cut(s) 533
AsuHPI GGTGA 1 cut(s) 527
BanI GGYRCC 1 cut(s) 433
BbsI GAAGAC 2 cut(s) 53, 582
BbvI GCAGC 3 cut(s) 115, 193, 502
BccI CCATC 1 cut(s) 690
BciT130I CCWGG 2 cut(s) 584, 722
BcnI CCSGG 1 cut(s) 533
BfaI CTAG 2 cut(s) 245, 315
BfmI CTRYAG 2 cut(s) 129, 277
BfoI RGCGCY 1 cut(s) 496
BglII AGATCT 1 cut(s) 672
BisI GCNGC 3 cut(s) 129, 182, 491
BlsI GCNGC 3 cut(s) 130, 183, 492
Bme1390I CCNGG 3 cut(s) 533, 584, 722
BmiI GGNNCC 3 cut(s) 105, 331, 435
BmrFI CCNGG 3 cut(s) 533, 584, 722
BmsI GCATC 2 cut(s) 201, 640
BpiI GAAGAC 2 cut(s) 53, 582
Bpu10I CCTNAGC 1 cut(s) 771
BpuEI CTTGAG 1 cut(s) 459
BpuMI CCSGG 1 cut(s) 533
BsaHI GRCGYC 1 cut(s) 14
BsaWI WCCGGW 1 cut(s) 512
BsaXI ACNNNNNCTCC 2 cut(s) 357, 387
Bsc4I CCNNNNNNNGG 1 cut(s) 52
Bse3DI GCAATG 2 cut(s) 258, 296
BseBI CCWGG 2 cut(s) 584, 722
BseGI GGATG 1 cut(s) 718
BseLI CCNNNNNNNGG 1 cut(s) 52
BseMI GCAATG 2 cut(s) 258, 296
BseMII CTCAG 1 cut(s) 43
BseXI GCAGC 3 cut(s) 115, 193, 502
BsgI GTGCAG 1 cut(s) 171
BshNI GGYRCC 1 cut(s) 433
BsiSI CCGG 2 cut(s) 513, 533
BslFI GGGAC 2 cut(s) 615, 641
BslI CCNNNNNNNGG 1 cut(s) 52
BsmFI GGGAC 2 cut(s) 615, 641
Bsp1407I TGTACA 1 cut(s) 252
Bsp143I GATC 6 cut(s) 68, 112, 219, 367, 517, 672
BspACI CCGC 3 cut(s) 184, 746, 764
BspCNI CTCAG 1 cut(s) 42
BspLI GGNNCC 3 cut(s) 105, 331, 435
BspMAI CTGCAG 1 cut(s) 133
BspPI GGATC 3 cut(s) 63, 214, 512
BspT107I GGYRCC 1 cut(s) 433
BsrDI GCAATG 2 cut(s) 258, 296
BsrGI TGTACA 1 cut(s) 252
BssMI GATC 6 cut(s) 68, 112, 219, 367, 517, 672
BssNI GRCGYC 1 cut(s) 14
Bst2UI CCWGG 2 cut(s) 584, 722
Bst4CI ACNGT 5 cut(s) 252, 344, 539, 688, 798
BstACI GRCGYC 1 cut(s) 14
BstAUI TGTACA 1 cut(s) 252
BstC8I GCNNGC 3 cut(s) 150, 702, 768
BstDEI CTNAG 2 cut(s) 29, 771
BstF5I GGATG 1 cut(s) 718
BstH2I RGCGCY 1 cut(s) 496
BstHHI GCGC 1 cut(s) 495
BstKTI GATC 6 cut(s) 71, 115, 222, 370, 520, 675
BstMBI GATC 6 cut(s) 68, 112, 219, 367, 517, 672
BstMWI GCNNNNNNNGC 1 cut(s) 385
BstNI CCWGG 2 cut(s) 584, 722
BstSCI CCNGG 3 cut(s) 531, 582, 720
BstSFI CTRYAG 2 cut(s) 129, 277
BstV1I GCAGC 3 cut(s) 115, 193, 502
BstV2I GAAGAC 2 cut(s) 53, 582
BstX2I RGATCY 2 cut(s) 68, 672
BstXI CCANNNNNNTGG 1 cut(s) 344
BstYI RGATCY 2 cut(s) 68, 672
BtsCI GGATG 1 cut(s) 718
BtsIMutI CAGTG 1 cut(s) 349
Cac8I GCNNGC 3 cut(s) 150, 702, 768
CfoI GCGC 1 cut(s) 495
CsiI ACCWGGT 1 cut(s) 582
Csp6I GTAC 2 cut(s) 228, 253
CviAII CATG 1 cut(s) 225
CviJI RGCY 7 cut(s) 28, 202, 244, 330, 669, 700, 770
CviKI_1 RGCY 7 cut(s) 28, 202, 244, 330, 669, 700, 770
CviQI GTAC 2 cut(s) 228, 253
DdeI CTNAG 2 cut(s) 29, 771
DpnI GATC 6 cut(s) 70, 114, 221, 369, 519, 674
DpnII GATC 6 cut(s) 68, 112, 219, 367, 517, 672
DraIII CACNNNGTG 1 cut(s) 586
EciI GGCGGA 2 cut(s) 735, 753
EcoRII CCWGG 2 cut(s) 582, 720
FaeI CATG 1 cut(s) 228
FaqI GGGAC 2 cut(s) 615, 641
FatI CATG 1 cut(s) 224
FblI GTMKAC 1 cut(s) 276
Fnu4HI GCNGC 3 cut(s) 129, 182, 491
FokI GGATG 1 cut(s) 725
Fsp4HI GCNGC 3 cut(s) 129, 182, 491
FspBI CTAG 2 cut(s) 245, 315
GlaI GCGC 1 cut(s) 494
GluI GCNGC 3 cut(s) 129, 182, 491
HaeII RGCGCY 1 cut(s) 496
HapII CCGG 2 cut(s) 513, 533
HhaI GCGC 1 cut(s) 495
Hin1I GRCGYC 1 cut(s) 14
Hin1II CATG 1 cut(s) 228
Hin6I GCGC 1 cut(s) 493
HinP1I GCGC 1 cut(s) 493
HincII GTYRAC 2 cut(s) 357, 718
HindII GTYRAC 2 cut(s) 357, 718
HinfI GANTC 1 cut(s) 788
HpaII CCGG 2 cut(s) 513, 533
HphI GGTGA 1 cut(s) 527
Hpy166II GTNNAC 3 cut(s) 277, 357, 718
Hpy188I TCNGA 4 cut(s) 160, 210, 235, 422
Hpy188III TCNNGA 4 cut(s) 89, 217, 409, 476
Hpy8I GTNNAC 3 cut(s) 277, 357, 718
HpyAV CCTTC 4 cut(s) 455, 473, 493, 752
HpyCH4III ACNGT 5 cut(s) 252, 344, 539, 688, 798
HpyCH4IV ACGT 3 cut(s) 14, 484, 642
HpyCH4V TGCA 5 cut(s) 131, 138, 152, 457, 571
HpyF10VI GCNNNNNNNGC 1 cut(s) 385
HpyF3I CTNAG 2 cut(s) 29, 771
HpySE526I ACGT 3 cut(s) 14, 484, 642
Hsp92I GRCGYC 1 cut(s) 14
Hsp92II CATG 1 cut(s) 228
HspAI GCGC 1 cut(s) 493
Kzo9I GATC 6 cut(s) 68, 112, 219, 367, 517, 672
LmnI GCTCC 1 cut(s) 335
Lsp1109I GCAGC 3 cut(s) 115, 193, 502
LweI GCATC 2 cut(s) 201, 640
MabI ACCWGGT 1 cut(s) 582
MaeI CTAG 2 cut(s) 245, 315
MaeII ACGT 3 cut(s) 14, 484, 642
MaeIII GTNAC 3 cut(s) 291, 643, 682
MalI GATC 6 cut(s) 70, 114, 221, 369, 519, 674
MboI GATC 6 cut(s) 68, 112, 219, 367, 517, 672
MboII GAAGA 5 cut(s) 53, 173, 248, 582, 752
MfeI CAATTG 1 cut(s) 566
MflI RGATCY 2 cut(s) 68, 672
MluCI AATT 4 cut(s) 310, 458, 566, 756
MmeI TCCRAC 2 cut(s) 357, 690
MnlI CCTC 3 cut(s) 312, 459, 759
MroXI GAANNNNTTC 1 cut(s) 416
MseI TTAA 3 cut(s) 441, 551, 597
MslI CAYNNNNRTG 1 cut(s) 342
MspA1I CMGCKG 1 cut(s) 184
MspI CCGG 2 cut(s) 513, 533
MspR9I CCNGG 3 cut(s) 533, 584, 722
MunI CAATTG 1 cut(s) 566
MvaI CCWGG 2 cut(s) 584, 722
MwoI GCNNNNNNNGC 1 cut(s) 385
NciI CCSGG 1 cut(s) 533
NdeII GATC 6 cut(s) 68, 112, 219, 367, 517, 672
NlaIII CATG 1 cut(s) 228
NlaIV GGNNCC 3 cut(s) 105, 331, 435
OliI CACNNNNGTG 1 cut(s) 342
PdmI GAANNNNTTC 1 cut(s) 416
PfeI GAWTC 1 cut(s) 788
PkrI GCNGC 3 cut(s) 130, 183, 492
PsiI TTATAA 2 cut(s) 168, 639
Psp1406I AACGTT 1 cut(s) 642
Psp6I CCWGG 2 cut(s) 582, 720
PspGI CCWGG 2 cut(s) 582, 720
PspN4I GGNNCC 3 cut(s) 105, 331, 435
PstI CTGCAG 1 cut(s) 133
PsuI RGATCY 2 cut(s) 68, 672
RsaI GTAC 2 cut(s) 229, 254
RsaNI GTAC 2 cut(s) 228, 253
RseI CAYNNNNRTG 1 cut(s) 342
SaqAI TTAA 3 cut(s) 441, 551, 597
SatI GCNGC 3 cut(s) 129, 182, 491
Sau3AI GATC 6 cut(s) 68, 112, 219, 367, 517, 672
ScrFI CCNGG 3 cut(s) 533, 584, 722
SexAI ACCWGGT 1 cut(s) 582
SfaNI GCATC 2 cut(s) 201, 640
SfcI CTRYAG 2 cut(s) 129, 277
SmiMI CAYNNNNRTG 1 cut(s) 342
SmlI CTYRAG 1 cut(s) 474
SmoI CTYRAG 1 cut(s) 474
Sse9I AATT 4 cut(s) 310, 458, 566, 756
SsiI CCGC 3 cut(s) 184, 746, 764
SspI AATATT 1 cut(s) 467
SspMI CTAG 2 cut(s) 245, 315
StyD4I CCNGG 3 cut(s) 531, 582, 720
TaaI ACNGT 5 cut(s) 252, 344, 539, 688, 798
TaiI ACGT 3 cut(s) 17, 487, 645
TaqI TCGA 1 cut(s) 288
TasI AATT 4 cut(s) 310, 458, 566, 756
TatI WGTACW 2 cut(s) 227, 252
TfiI GAWTC 1 cut(s) 788
Tru1I TTAA 3 cut(s) 441, 551, 597
Tru9I TTAA 3 cut(s) 441, 551, 597
TscAI CASTG 1 cut(s) 349
TseI GCWGC 3 cut(s) 128, 181, 490
TspDTI ATGAA 2 cut(s) 186, 611
TspRI CASTG 1 cut(s) 349
XapI RAATTY 1 cut(s) 756
XcmI CCANNNNNNNNNTGG 1 cut(s) 344
XmiI GTMKAC 1 cut(s) 276
XmnI GAANNNNTTC 1 cut(s) 416
XspI CTAG 2 cut(s) 245, 315
ZraI GACGTC 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.