Rmu_sc0002414.1_g000044

F-box kelch-repeat protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002414.1
Physical Location & Seq
Reverse (-)
159252 .. 161539
2288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002414.1_g000044.1.cds

Sequence Viewer

Length: 1128 bp
atgactgtcaggaagaggaagctgaaactgttgtctgaaacagcgtcaactggtacaggaagagctagattcaggaagaatgagaatttggagcttcaaacctggtcagagctccccatagaacttgtggaaatcattgcatcccttttatctctagaagataacattcgagcatctgctgtatgcaagagatggcattcagctgccgtttctgtgcgggtagtcaaccgagcacccctactgatgtactttccaaaatttggtagcctgtttgaattctatgatccatcacagcgcaaaatccactttgtggagattcctcagctgattgggtctagggtttgctacaccaaagatggttggttgttgctatacagacccaaaactttccgtgtgttctttttcaatccttttactcaggaagtggtcaagttaccaagatttgagttgaattatcagattgttgcgttctcttctgccccaacttctacaagctgcatggtttttaccataaaacatgtcaatcccacagttgttgctattagcacttgtcatcctggggcagaacagtggactaccattcagtatcaaaaccgtttgccatttgtgagtagcatttggaacaagcttgttttctgtaatgacctcttttattgtcaaagcctcacaggttgggtgggtgtattcaacccacatgaacgaacttggagtgtcctttcagttcctcctccgaaatgccctgagaaatttttcgctaaaagttggtggaaaggtaagtttatgactgagaaggatggagatatattagttatatatacatgttctactgaaaacccaattgcattcaagttggaccagaggaacatggcttgggaagagctgaaaatcctagatggtgcgactgtttttgctagtttcttgacaactcatacaaacattgacctccctgcaataaagagaaacagtatttacttctctaaagttcgtttttatggaaggcagtgcatatcatactcacttgtagatggtagatatcatcctcgcaatgagtgccatgactggggagagcaagatcctttcaagaccatttggattgaaccacctgaagacttctcaggcttcaactaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

375

Amino Acids

43.56

Weight (kDa)

9.06

Isoelectric Point (pI)

43.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013403)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 2 cut(s) 260, 310
AciI CCGC 1 cut(s) 217
AclWI GGATC 2 cut(s) 278, 1067
AcsI RAATTY 4 cut(s) 85, 257, 275, 746
AcuI CTGAAG 1 cut(s) 1125
AdeI CACNNNGTG 1 cut(s) 310
AfaI GTAC 2 cut(s) 55, 248
AfiI CCNNNNNNNGG 3 cut(s) 260, 310, 1060
AflIII ACRYGT 2 cut(s) 517, 818
AgsI TTSAA 9 cut(s) 98, 275, 406, 451, 688, 847, 1081, 1097, 1123
AjnI CCWGG 2 cut(s) 101, 556
AjuI GAANNNNNNNTTGG 2 cut(s) 71, 103
AluBI AGCT 9 cut(s) 22, 65, 94, 112, 203, 325, 495, 628, 880
AluI AGCT 9 cut(s) 22, 65, 94, 112, 203, 325, 495, 628, 880
Alw21I GWGCWC 2 cut(s) 114, 235
AlwI GGATC 2 cut(s) 278, 1067
ApeKI GCWGC 2 cut(s) 203, 495
ApoI RAATTY 4 cut(s) 85, 257, 275, 746
Asp700I GAANNNNTTC 1 cut(s) 749
AspLEI GCGC 1 cut(s) 297
AspS9I GGNCC 1 cut(s) 853
AvaII GGWCC 1 cut(s) 853
BanII GRGCYC 1 cut(s) 114
BbsI GAAGAC 1 cut(s) 1113
Bbv12I GWGCWC 2 cut(s) 114, 235
BbvCI CCTCAGC 1 cut(s) 321
BbvI GCAGC 2 cut(s) 190, 482
BccI CCATC 6 cut(s) 186, 295, 350, 788, 887, 1019
BceAI ACGGC 1 cut(s) 191
BciT130I CCWGG 2 cut(s) 103, 558
BfaI CTAG 5 cut(s) 66, 155, 336, 890, 912
BisI GCNGC 2 cut(s) 204, 496
BlsI GCNGC 2 cut(s) 205, 497
Bme1390I CCNGG 2 cut(s) 103, 558
Bme18I GGWCC 1 cut(s) 853
BmgT120I GGNCC 1 cut(s) 853
BmrFI CCNGG 2 cut(s) 103, 558
BmrI ACTGGG 1 cut(s) 1069
BmsI GCATC 2 cut(s) 149, 182
BmuI ACTGGG 1 cut(s) 1069
BpiI GAAGAC 1 cut(s) 1113
Bpu10I CCTNAGC 1 cut(s) 321
BsaJI CCNNGG 1 cut(s) 557
Bsc4I CCNNNNNNNGG 3 cut(s) 260, 310, 1060
Bse1I ACTGG 2 cut(s) 55, 1064
Bse3DI GCAATG 2 cut(s) 135, 1051
BseBI CCWGG 2 cut(s) 103, 558
BseDI CCNNGG 1 cut(s) 557
BseGI GGATG 4 cut(s) 140, 553, 799, 1036
BseLI CCNNNNNNNGG 3 cut(s) 260, 310, 1060
BseMI GCAATG 2 cut(s) 135, 1051
BseMII CTCAG 5 cut(s) 335, 431, 732, 777, 1128
BseNI ACTGG 2 cut(s) 55, 1064
BseRI GAGGAG 1 cut(s) 717
BseXI GCAGC 2 cut(s) 190, 482
BsiHKAI GWGCWC 2 cut(s) 114, 235
BslI CCNNNNNNNGG 3 cut(s) 260, 310, 1060
BsmI GAATGC 2 cut(s) 196, 842
Bsp1286I GDGCHC 2 cut(s) 114, 235
Bsp143I GATC 2 cut(s) 283, 1072
BspACI CCGC 1 cut(s) 217
BspCNI CTCAG 5 cut(s) 334, 430, 733, 778, 1127
BspPI GGATC 2 cut(s) 278, 1067
BspQI GCTCTTC 2 cut(s) 55, 870
BsrDI GCAATG 2 cut(s) 135, 1051
BsrI ACTGG 2 cut(s) 55, 1064
BssECI CCNNGG 1 cut(s) 557
BssMI GATC 2 cut(s) 283, 1072
Bst2UI CCWGG 2 cut(s) 103, 558
Bst4CI ACNGT 7 cut(s) 7, 30, 532, 570, 596, 904, 965
Bst6I CTCTTC 4 cut(s) 8, 55, 478, 870
BstAPI GCANNNNNTGC 1 cut(s) 1050
BstDEI CTNAG 5 cut(s) 321, 417, 741, 786, 1114
BstF5I GGATG 4 cut(s) 140, 553, 799, 1036
BstHHI GCGC 1 cut(s) 297
BstKTI GATC 2 cut(s) 286, 1075
BstMBI GATC 2 cut(s) 283, 1072
BstMWI GCNNNNNNNGC 1 cut(s) 1050
BstNI CCWGG 2 cut(s) 103, 558
BstNSI RCATGY 2 cut(s) 521, 822
BstSCI CCNGG 2 cut(s) 101, 556
BstV1I GCAGC 2 cut(s) 190, 482
BstV2I GAAGAC 1 cut(s) 1113
BstX2I RGATCY 1 cut(s) 1072
BstYI RGATCY 1 cut(s) 1072
BtsCI GGATG 4 cut(s) 140, 553, 799, 1036
BtsI GCAGTG 1 cut(s) 1007
BtsIMutI CAGTG 2 cut(s) 575, 1007
CfoI GCGC 1 cut(s) 297
Cfr13I GGNCC 1 cut(s) 853
CseI GACGC 1 cut(s) 33
CsiI ACCWGGT 1 cut(s) 101
Csp6I GTAC 2 cut(s) 54, 247
CspCI CAANNNNNGTGG 2 cut(s) 517, 552
CviAII CATG 6 cut(s) 499, 518, 695, 819, 865, 1055
CviQI GTAC 2 cut(s) 54, 247
DdeI CTNAG 5 cut(s) 321, 417, 741, 786, 1114
DpnI GATC 2 cut(s) 285, 1074
DpnII GATC 2 cut(s) 283, 1072
DraIII CACNNNGTG 1 cut(s) 310
Eam1104I CTCTTC 4 cut(s) 8, 55, 478, 870
EarI CTCTTC 4 cut(s) 8, 55, 478, 870
Ecl136II GAGCTC 1 cut(s) 112
Eco24I GRGCYC 1 cut(s) 114
Eco32I GATATC 1 cut(s) 1034
Eco47I GGWCC 1 cut(s) 853
Eco53kI GAGCTC 1 cut(s) 112
Eco57I CTGAAG 1 cut(s) 1125
EcoICRI GAGCTC 1 cut(s) 112
EcoRI GAATTC 1 cut(s) 275
EcoRII CCWGG 2 cut(s) 101, 556
EcoRV GATATC 1 cut(s) 1034
EcoT38I GRGCYC 1 cut(s) 114
FaeI CATG 6 cut(s) 502, 521, 698, 822, 868, 1058
FatI CATG 6 cut(s) 498, 517, 694, 818, 864, 1054
FauI CCCGC 1 cut(s) 210
Fnu4HI GCNGC 2 cut(s) 204, 496
FokI GGATG 4 cut(s) 127, 540, 806, 1023
FriOI GRGCYC 1 cut(s) 114
Fsp4HI GCNGC 2 cut(s) 204, 496
FspBI CTAG 5 cut(s) 66, 155, 336, 890, 912
GlaI GCGC 1 cut(s) 296
GluI GCNGC 2 cut(s) 204, 496
HgaI GACGC 1 cut(s) 33
HhaI GCGC 1 cut(s) 297
Hin1II CATG 6 cut(s) 502, 521, 698, 822, 868, 1058
Hin6I GCGC 1 cut(s) 295
HinP1I GCGC 1 cut(s) 295
HincII GTYRAC 2 cut(s) 48, 226
HindII GTYRAC 2 cut(s) 48, 226
HindIII AAGCTT 1 cut(s) 626
HinfI GANTC 2 cut(s) 69, 316
Hpy166II GTNNAC 3 cut(s) 48, 226, 573
Hpy188I TCNGA 4 cut(s) 37, 109, 459, 732
Hpy188III TCNNGA 6 cut(s) 10, 73, 155, 419, 919, 1081
Hpy8I GTNNAC 3 cut(s) 48, 226, 573
HpyAV CCTTC 2 cut(s) 784, 990
HpyCH4III ACNGT 7 cut(s) 7, 30, 532, 570, 596, 904, 965
HpyCH4V TGCA 6 cut(s) 140, 186, 498, 842, 950, 1005
HpyF10VI GCNNNNNNNGC 1 cut(s) 1050
HpyF3I CTNAG 5 cut(s) 321, 417, 741, 786, 1114
Hsp92II CATG 6 cut(s) 502, 521, 698, 822, 868, 1058
HspAI GCGC 1 cut(s) 295
Kzo9I GATC 2 cut(s) 283, 1072
LguI GCTCTTC 2 cut(s) 55, 870
LmnI GCTCC 2 cut(s) 91, 117
Lsp1109I GCAGC 2 cut(s) 190, 482
LweI GCATC 2 cut(s) 149, 182
MabI ACCWGGT 1 cut(s) 101
MaeI CTAG 5 cut(s) 66, 155, 336, 890, 912
MaeIII GTNAC 1 cut(s) 432
MalI GATC 2 cut(s) 285, 1074
MboI GATC 2 cut(s) 283, 1072
MboII GAAGA 7 cut(s) 25, 72, 88, 170, 465, 887, 1118
MfeI CAATTG 1 cut(s) 837
MflI RGATCY 1 cut(s) 1072
MhlI GDGCHC 2 cut(s) 114, 235
MluCI AATT 6 cut(s) 85, 257, 275, 451, 746, 837
MmeI TCCRAC 1 cut(s) 831
MnlI CCTC 9 cut(s) 9, 330, 656, 674, 735, 738, 852, 953, 1050
MroXI GAANNNNTTC 1 cut(s) 749
MspA1I CMGCKG 2 cut(s) 203, 325
MspR9I CCNGG 2 cut(s) 103, 558
MunI CAATTG 1 cut(s) 837
Mva1269I GAATGC 2 cut(s) 196, 842
MvaI CCWGG 2 cut(s) 103, 558
MwoI GCNNNNNNNGC 1 cut(s) 1050
NdeII GATC 2 cut(s) 283, 1072
NlaIII CATG 6 cut(s) 502, 521, 698, 822, 868, 1058
NspI RCATGY 2 cut(s) 521, 822
PciI ACATGT 2 cut(s) 517, 818
PciSI GCTCTTC 2 cut(s) 55, 870
PctI GAATGC 2 cut(s) 196, 842
PdmI GAANNNNTTC 1 cut(s) 749
PfeI GAWTC 2 cut(s) 69, 316
PflMI CCANNNNNTGG 2 cut(s) 260, 310
PkrI GCNGC 2 cut(s) 205, 497
PscI ACATGT 2 cut(s) 517, 818
Psp124BI GAGCTC 1 cut(s) 114
Psp6I CCWGG 2 cut(s) 101, 556
PspGI CCWGG 2 cut(s) 101, 556
PspPI GGNCC 1 cut(s) 853
PsuI RGATCY 1 cut(s) 1072
PvuII CAGCTG 2 cut(s) 203, 325
RsaI GTAC 2 cut(s) 55, 248
RsaNI GTAC 2 cut(s) 54, 247
SacI GAGCTC 1 cut(s) 114
SapI GCTCTTC 2 cut(s) 55, 870
SatI GCNGC 2 cut(s) 204, 496
Sau3AI GATC 2 cut(s) 283, 1072
Sau96I GGNCC 1 cut(s) 853
ScrFI CCNGG 2 cut(s) 103, 558
SduI GDGCHC 2 cut(s) 114, 235
SexAI ACCWGGT 1 cut(s) 101
SfaNI GCATC 2 cut(s) 149, 182
SinI GGWCC 1 cut(s) 853
Sse9I AATT 6 cut(s) 85, 257, 275, 451, 746, 837
SsiI CCGC 1 cut(s) 217
SspMI CTAG 5 cut(s) 66, 155, 336, 890, 912
SstI GAGCTC 1 cut(s) 114
StyD4I CCNGG 2 cut(s) 101, 556
TaaI ACNGT 7 cut(s) 7, 30, 532, 570, 596, 904, 965
TaqI TCGA 1 cut(s) 169
TasI AATT 6 cut(s) 85, 257, 275, 451, 746, 837
TatI WGTACW 1 cut(s) 246
TfiI GAWTC 2 cut(s) 69, 316
TscAI CASTG 2 cut(s) 575, 1007
TseI GCWGC 2 cut(s) 203, 495
TspDTI ATGAA 1 cut(s) 711
TspGWI ACGGA 1 cut(s) 380
TspRI CASTG 2 cut(s) 575, 1007
Van91I CCANNNNNTGG 2 cut(s) 260, 310
VpaK11BI GGWCC 1 cut(s) 853
XapI RAATTY 4 cut(s) 85, 257, 275, 746
XbaI TCTAGA 1 cut(s) 154
XceI RCATGY 2 cut(s) 521, 822
XcmI CCANNNNNNNNNTGG 1 cut(s) 124
XmnI GAANNNNTTC 1 cut(s) 749
XspI CTAG 5 cut(s) 66, 155, 336, 890, 912
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.