Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002522.1

Orthogroup ID

OG0017752

Physical Location & Seq

Genomic Coordinates Reverse (-)

112279 .. 113653

Gene Structure 1375 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002522.1_g000031.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 423 bp

atgtgcctcttgcgtgactgcagcgtctacgaaagcccagaaaatgaatttttggaacctttcaagaggccctttcaccgtggccttccatccgacagtttggtttatcaagatgacaagctgcaggggtgtgttgaccgcactctagacagtagggctttcagaggctggattgagacagataactcttggaaaaatgatgacgagactgataatgatgagataacatatgtgaaccttctaccgaaccctgaacgttacactggctattctggtccatcagcaagaaggatatgggatgctgtttattctgaaaattgcccaaaatgtatttgcgacggcatttttcagttgcaaaatgtttgcgacggcaagacgttgccgtcgctaataagcttgcgacgatgcattagccgtcgctaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003756 GO:0003824 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005783 GO:0005789 GO:0006457 GO:0006464 GO:0006807 GO:0008150 GO:0008152 GO:0009987 GO:0012505 GO:0015035 GO:0015036 GO:0016020 GO:0016491 GO:0016667 GO:0016853 GO:0016860 GO:0016864 GO:0019538 GO:0031984 GO:0034975 GO:0036211 GO:0042175 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044260 GO:0044267 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044444 GO:0044446 GO:0044464 GO:0055114 GO:0071704 GO:0098827 GO:0140096 GO:1901564

KEGG Pathways

Metabolic & Signaling

ko04141 ko05110 map04141 map05110

Pfam Domains

Protein Families

ERO1

Protein Analysis

140

Amino Acids

16.25

Weight (kDa)

4.91

Isoelectric Point (pI)

60.06

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017752)

Species	Orthologous Gene IDs
prunus_persica	Prupe.4G145200_v2.0.a1 Prupe.4G145200_v2.0.a1
rosa_multiflora	Rmu_sc0000689.1_g000027 Rmu_sc0000882.1_g000037 Rmu_sc0002522.1_g000031 Rmu_sc0006065.1_g000014 Rmu_sc0014478.1_g000016
rosa_rugosa	Rorug02G0232200 Rorug06G0256800
rosa_samantha	Rh2CG037300 Rh5AG086600 Rh5AG304000

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AasI	GACNNNNNNGTC	2 cut(s)	23, 382
AccI	GTMKAC	1 cut(s)	27
AciI	CCGC	1 cut(s)	139
AclI	AACGTT	1 cut(s)	256
AcsI	RAATTY	1 cut(s)	47
AgsI	TTSAA	1 cut(s)	64
AluBI	AGCT	2 cut(s)	121, 396
AluI	AGCT	2 cut(s)	121, 396
Alw26I	GTCTC	2 cut(s)	170, 200
AlwNI	CAGNNNCTG	1 cut(s)	168
AoxI	GGCC	2 cut(s)	68, 82
ApeKI	GCWGC	2 cut(s)	21, 121
ApoI	RAATTY	1 cut(s)	47
AspS9I	GGNCC	2 cut(s)	69, 275
AsuHPI	GGTGA	1 cut(s)	68
AvaII	GGWCC	1 cut(s)	275
BbvI	GCAGC	2 cut(s)	33, 108
BccI	CCATC	2 cut(s)	97, 286
BceAI	ACGGC	4 cut(s)	355, 367, 385, 399
BcoDI	GTCTC	2 cut(s)	170, 200
BfaI	CTAG	1 cut(s)	146
BfmI	CTRYAG	2 cut(s)	19, 122
BisI	GCNGC	2 cut(s)	22, 122
BlsI	GCNGC	2 cut(s)	23, 123
Bme18I	GGWCC	1 cut(s)	275
BmgT120I	GGNCC	2 cut(s)	69, 275
BmiI	GGNNCC	1 cut(s)	57
BmsI	GCATC	2 cut(s)	289, 395
BsaJI	CCNNGG	1 cut(s)	79
Bse1I	ACTGG	1 cut(s)	268
BseDI	CCNNGG	1 cut(s)	79
BseGI	GGATG	2 cut(s)	89, 304
BseNI	ACTGG	1 cut(s)	268
BseXI	GCAGC	2 cut(s)	33, 108
BshFI	GGCC	2 cut(s)	70, 84
BsmAI	GTCTC	2 cut(s)	170, 200
BsnI	GGCC	2 cut(s)	70, 84
BspACI	CCGC	1 cut(s)	139
BspANI	GGCC	2 cut(s)	70, 84
BspLI	GGNNCC	1 cut(s)	57
BspMAI	CTGCAG	2 cut(s)	23, 126
BsrI	ACTGG	1 cut(s)	268
BssECI	CCNNGG	1 cut(s)	79
Bst4CI	ACNGT	3 cut(s)	80, 98, 152
BstC8I	GCNNGC	1 cut(s)	398
BstDSI	CCRYGG	1 cut(s)	79
BstF5I	GGATG	2 cut(s)	89, 304
BstMAI	GTCTC	2 cut(s)	170, 200
BstSFI	CTRYAG	2 cut(s)	19, 122
BstV1I	GCAGC	2 cut(s)	33, 108
BsuRI	GGCC	2 cut(s)	70, 84
BtgI	CCRYGG	1 cut(s)	79
BtsCI	GGATG	2 cut(s)	89, 304
BtsIMutI	CAGTG	1 cut(s)	261
Cac8I	GCNNGC	1 cut(s)	398
CaiI	CAGNNNCTG	1 cut(s)	168
Cfr13I	GGNCC	2 cut(s)	69, 275
CseI	GACGC	1 cut(s)	13
CviJI	RGCY	9 cut(s)	36, 70, 84, 121, 158, 168, 267, 396, 414
CviKI_1	RGCY	9 cut(s)	36, 70, 84, 121, 158, 168, 267, 396, 414
DrdI	GACNNNNNNGTC	2 cut(s)	23, 382
DseDI	GACNNNNNNGTC	2 cut(s)	23, 382
Eco47I	GGWCC	1 cut(s)	275
EcoO109I	RGGNCCY	1 cut(s)	69
EcoT22I	ATGCAT	1 cut(s)	410
FaiI	YATR	3 cut(s)	229, 231, 295
FalI	AAGNNNNNCTT	2 cut(s)	56, 88
FauNDI	CATATG	1 cut(s)	229
FblI	GTMKAC	1 cut(s)	27
Fnu4HI	GCNGC	2 cut(s)	22, 122
FokI	GGATG	2 cut(s)	76, 311
Fsp4HI	GCNGC	2 cut(s)	22, 122
FspBI	CTAG	1 cut(s)	146
GluI	GCNGC	2 cut(s)	22, 122
HaeIII	GGCC	2 cut(s)	70, 84
HgaI	GACGC	1 cut(s)	13
HincII	GTYRAC	1 cut(s)	136
HindII	GTYRAC	1 cut(s)	136
HindIII	AAGCTT	1 cut(s)	394
HphI	GGTGA	1 cut(s)	68
Hpy166II	GTNNAC	3 cut(s)	28, 136, 235
Hpy188I	TCNGA	3 cut(s)	94, 164, 313
Hpy188III	TCNNGA	3 cut(s)	64, 110, 146
Hpy8I	GTNNAC	3 cut(s)	28, 136, 235
Hpy99I	CGWCG	5 cut(s)	341, 371, 388, 405, 420
HpyAV	CCTTC	3 cut(s)	95, 248, 282
HpyCH4III	ACNGT	3 cut(s)	80, 98, 152
HpyCH4IV	ACGT	2 cut(s)	256, 377
HpyCH4V	TGCA	4 cut(s)	21, 124, 355, 408
HpySE526I	ACGT	2 cut(s)	256, 377
LpnPI	CCDG	6 cut(s)	51, 110, 154, 249, 258, 264
Lsp1109I	GCAGC	2 cut(s)	33, 108
LweI	GCATC	2 cut(s)	289, 395
MaeI	CTAG	1 cut(s)	146
MaeII	ACGT	2 cut(s)	256, 377
MaeIII	GTNAC	2 cut(s)	14, 257
MluCI	AATT	2 cut(s)	47, 316
MmeI	TCCRAC	1 cut(s)	117
MnlI	CCTC	3 cut(s)	17, 60, 158
Mph1103I	ATGCAT	1 cut(s)	410
NdeI	CATATG	1 cut(s)	229
NlaIV	GGNNCC	1 cut(s)	57
NmuCI	GTSAC	1 cut(s)	14
NsiI	ATGCAT	1 cut(s)	410
PkrI	GCNGC	2 cut(s)	23, 123
Psp1406I	AACGTT	1 cut(s)	256
PspN4I	GGNNCC	1 cut(s)	57
PspPI	GGNCC	2 cut(s)	69, 275
PstI	CTGCAG	2 cut(s)	23, 126
PstNI	CAGNNNCTG	1 cut(s)	168
SatI	GCNGC	2 cut(s)	22, 122
Sau96I	GGNCC	2 cut(s)	69, 275
SetI	ASST	6 cut(s)	61, 123, 240, 259, 380, 398
SfaNI	GCATC	2 cut(s)	289, 395
SfcI	CTRYAG	2 cut(s)	19, 122
SinI	GGWCC	1 cut(s)	275
Sse9I	AATT	2 cut(s)	47, 316
SsiI	CCGC	1 cut(s)	139
SspMI	CTAG	1 cut(s)	146
TaaI	ACNGT	3 cut(s)	80, 98, 152
TaiI	ACGT	2 cut(s)	259, 380
TasI	AATT	2 cut(s)	47, 316
TscAI	CASTG	1 cut(s)	268
TseFI	GTSAC	1 cut(s)	14
TseI	GCWGC	2 cut(s)	21, 121
Tsp45I	GTSAC	1 cut(s)	14
TspDTI	ATGAA	1 cut(s)	60
TspRI	CASTG	1 cut(s)	268
VpaK11BI	GGWCC	1 cut(s)	275
XapI	RAATTY	1 cut(s)	47
XbaI	TCTAGA	1 cut(s)	145
XmiI	GTMKAC	1 cut(s)	27
XspI	CTAG	1 cut(s)	146
Zsp2I	ATGCAT	1 cut(s)	410

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.