Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0003188.1

Orthogroup ID

OG0006519

Physical Location & Seq

Genomic Coordinates Forward (+)

158283 .. 161311

Gene Structure 3029 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0003188.1_g000033.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 852 bp

atgaagaaggaatggtgtaaacccaaatgggtttctcttctgttcctctgtttctcactatctctgcaatttactactgtttctcctctgtctctgccaacagatcagaactatgaggaatttgcaaccacaaggacttttaggggggaggcatcggatatgcccgaggtacattgttcgagagaaaggagtaaggcagcatggaaagtaattgaggagtatttaatgccctatgtagagaaagagcggtatcagattccgagaacgtgtaggctgcaccctgataatgatctgtacagagatcaggaacagcacaaaatccgaatagatatatatgaatggcagtgtggatactgtaagaagagattttacgaggagaagtttcttgacaagcattttgacaacaggcatcacaatttgctgaatgtgagtcatagtaggtgcttagcagatgtctgtggtgcgttgcactgtgatgttgcaatgggtgctgccccacacaagaccaagtgcaatcctgctgctgctgcacggaataaacatctgtgtgagggtctagcggatagttgttttccagtcaatcagggtccttcagcaaaccgtttacatgaattctttttacgccaattctgtgatgccctcacttgcactggacgccagaaaccattctctcagggacgcaagaagaggagcatgagtatatcttacattgttatttccgttctgactttgatgctgctcctcctttactatacttatctttacatctacagaagtggaattaaaaggggaactcaagacctgaaacgagtctcacttacgcagagtggaaggaagaaaaagccctcttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

283

Amino Acids

33.08

Weight (kDa)

9.27

Isoelectric Point (pI)

44.7

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0006519)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G40710 AT5G40710
fragaria_vesca	FvH4_6g52420 FvH4_6g52420 FvH4_6g52420 FvH4_6g52420 FvH4_6g52420 FvH4_6g52420 FvH4_6g52420
malus_domestica	MD09G1018200.v1.1
prunus_persica	Prupe.3G298900_v2.0.a1 Prupe.3G298900_v2.0.a1
pyrus_communis	pycom111g01520
rosa_chinensis	RchiOBHm_Chr2g0174061
rosa_laevigata	RLG00000022241
rosa_multiflora	Rmu_sc0003188.1_g000033 Rmu_sc0041487.1_g000001
rosa_roxburghii	Rroxscaffold_2G00078490
rosa_rugosa	Rorug02G0574300 Rorug02G0574400 Rorug02G0574500
rosa_samantha	Rh2AG653700 Rh2BG665000 Rh2CG629300 Rh2DG679700
rosa_wichuraiana	Rw2G053680

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccBSI	CCGCTC	1 cut(s)	247
AciI	CCGC	2 cut(s)	247, 560
AcsI	RAATTY	2 cut(s)	119, 611
AcuI	CTGAAG	1 cut(s)	576
AcyI	GRCGYC	1 cut(s)	655
AfaI	GTAC	2 cut(s)	171, 296
AflIII	ACRYGT	1 cut(s)	266
Alw26I	GTCTC	2 cut(s)	96, 817
Ama87I	CYCGRG	1 cut(s)	164
ApeKI	GCWGC	7 cut(s)	197, 274, 491, 521, 524, 527, 736
ApoI	RAATTY	2 cut(s)	119, 611
ArsI	GACNNNNNNTTYG	2 cut(s)	380, 412
Asp700I	GAANNNNTTC	1 cut(s)	665
AspS9I	GGNCC	1 cut(s)	587
AvaI	CYCGRG	1 cut(s)	164
AvaII	GGWCC	1 cut(s)	587
BarI	GAAGNNNNNNTAC	2 cut(s)	353, 385
BbvI	GCAGC	7 cut(s)	209, 261, 478, 508, 511, 514, 723
BciVI	GTATCC	1 cut(s)	344
BcoDI	GTCTC	2 cut(s)	96, 817
BfaI	CTAG	1 cut(s)	557
BfmI	CTRYAG	1 cut(s)	769
BfuI	GTATCC	1 cut(s)	344
BisI	GCNGC	7 cut(s)	198, 275, 492, 522, 525, 528, 737
BlpI	GCTNAGC	1 cut(s)	445
BlsI	GCNGC	7 cut(s)	199, 276, 493, 523, 526, 529, 738
Bme18I	GGWCC	1 cut(s)	587
BmeT110I	CYCGRG	1 cut(s)	164
BmgT120I	GGNCC	1 cut(s)	587
BmiI	GGNNCC	1 cut(s)	588
BmsI	GCATC	4 cut(s)	161, 418, 625, 723
Bpu1102I	GCTNAGC	1 cut(s)	445
BpuEI	CTTGAG	1 cut(s)	780
BsaBI	GATNNNNATC	1 cut(s)	288
BsaHI	GRCGYC	1 cut(s)	655
BsaJI	CCNNGG	1 cut(s)	165
BsaXI	ACNNNNNCTCC	4 cut(s)	67, 97, 682, 712
Bse1I	ACTGG	2 cut(s)	575, 655
Bse3DI	GCAATG	1 cut(s)	489
Bse8I	GATNNNNATC	1 cut(s)	288
BseDI	CCNNGG	1 cut(s)	165
BseJI	GATNNNNATC	1 cut(s)	288
BseMI	GCAATG	1 cut(s)	489
BseMII	CTCAG	1 cut(s)	686
BseNI	ACTGG	2 cut(s)	575, 655
BseRI	GAGGAG	5 cut(s)	75, 230, 389, 703, 731
BseXI	GCAGC	7 cut(s)	209, 261, 478, 508, 511, 514, 723
BsgI	GTGCAG	2 cut(s)	260, 513
BsiHKCI	CYCGRG	1 cut(s)	164
BslFI	GGGAC	1 cut(s)	690
BsmAI	GTCTC	2 cut(s)	96, 817
BsmFI	GGGAC	1 cut(s)	690
BsoBI	CYCGRG	1 cut(s)	164
Bsp1407I	TGTACA	1 cut(s)	294
Bsp143I	GATC	3 cut(s)	103, 289, 301
Bsp1720I	GCTNAGC	1 cut(s)	445
BspACI	CCGC	2 cut(s)	247, 560
BspCNI	CTCAG	1 cut(s)	685
BspLI	GGNNCC	1 cut(s)	588
BsrBI	CCGCTC	1 cut(s)	247
BsrDI	GCAATG	1 cut(s)	489
BsrGI	TGTACA	1 cut(s)	294
BsrI	ACTGG	2 cut(s)	575, 655
BssECI	CCNNGG	1 cut(s)	165
BssMI	GATC	3 cut(s)	103, 289, 301
BssNI	GRCGYC	1 cut(s)	655
Bst4CI	ACNGT	4 cut(s)	79, 356, 473, 602
Bst6I	CTCTTC	3 cut(s)	42, 356, 680
BstACI	GRCGYC	1 cut(s)	655
BstAPI	GCANNNNNTGC	1 cut(s)	488
BstAUI	TGTACA	1 cut(s)	294
BstDEI	CTNAG	3 cut(s)	445, 672, 849
BstKTI	GATC	3 cut(s)	106, 292, 304
BstMAI	GTCTC	2 cut(s)	96, 817
BstMBI	GATC	3 cut(s)	103, 289, 301
BstMWI	GCNNNNNNNGC	3 cut(s)	488, 527, 654
BstSFI	CTRYAG	1 cut(s)	769
BstV1I	GCAGC	7 cut(s)	209, 261, 478, 508, 511, 514, 723
BsuI	GTATCC	1 cut(s)	344
BtsI	GCAGTG	1 cut(s)	350
BtsIMutI	CAGTG	3 cut(s)	350, 469, 648
Cfr13I	GGNCC	1 cut(s)	587
CseI	GACGC	2 cut(s)	663, 687
Csp6I	GTAC	2 cut(s)	170, 295
CviAII	CATG	3 cut(s)	201, 608, 694
CviJI	RGCY	2 cut(s)	274, 844
CviKI_1	RGCY	2 cut(s)	274, 844
CviQI	GTAC	2 cut(s)	170, 295
DdeI	CTNAG	3 cut(s)	445, 672, 849
DpnI	GATC	3 cut(s)	105, 291, 303
DpnII	GATC	3 cut(s)	103, 289, 301
Eam1104I	CTCTTC	3 cut(s)	42, 356, 680
EarI	CTCTTC	3 cut(s)	42, 356, 680
Eco47I	GGWCC	1 cut(s)	587
Eco57I	CTGAAG	1 cut(s)	576
Eco88I	CYCGRG	1 cut(s)	164
EcoO109I	RGGNCCY	1 cut(s)	587
EcoRI	GAATTC	1 cut(s)	611
FaeI	CATG	3 cut(s)	204, 611, 697
FaqI	GGGAC	1 cut(s)	690
FatI	CATG	3 cut(s)	200, 607, 693
Fnu4HI	GCNGC	7 cut(s)	198, 275, 492, 522, 525, 528, 737
Fsp4HI	GCNGC	7 cut(s)	198, 275, 492, 522, 525, 528, 737
FspBI	CTAG	1 cut(s)	557
GluI	GCNGC	7 cut(s)	198, 275, 492, 522, 525, 528, 737
HgaI	GACGC	2 cut(s)	663, 687
Hin1I	GRCGYC	1 cut(s)	655
Hin1II	CATG	3 cut(s)	204, 611, 697
HinfI	GANTC	3 cut(s)	256, 430, 810
Hpy166II	GTNNAC	2 cut(s)	20, 605
Hpy188I	TCNGA	6 cut(s)	108, 157, 255, 261, 323, 726
Hpy188III	TCNNGA	4 cut(s)	180, 305, 386, 797
Hpy8I	GTNNAC	2 cut(s)	20, 605
HpyAV	CCTTC	2 cut(s)	600, 825
HpyCH4III	ACNGT	4 cut(s)	79, 356, 473, 602
HpyCH4IV	ACGT	1 cut(s)	266
HpyCH4V	TGCA	8 cut(s)	67, 125, 277, 469, 482, 513, 530, 648
HpyF10VI	GCNNNNNNNGC	3 cut(s)	488, 527, 654
HpyF3I	CTNAG	3 cut(s)	445, 672, 849
HpySE526I	ACGT	1 cut(s)	266
Hsp92I	GRCGYC	1 cut(s)	655
Hsp92II	CATG	3 cut(s)	204, 611, 697
Kzo9I	GATC	3 cut(s)	103, 289, 301
LmnI	GCTCC	2 cut(s)	690, 744
Lsp1109I	GCAGC	7 cut(s)	209, 261, 478, 508, 511, 514, 723
LweI	GCATC	4 cut(s)	161, 418, 625, 723
MaeI	CTAG	1 cut(s)	557
MaeII	ACGT	1 cut(s)	266
MalI	GATC	3 cut(s)	105, 291, 303
MbiI	CCGCTC	1 cut(s)	247
MboI	GATC	3 cut(s)	103, 289, 301
MboII	GAAGA	5 cut(s)	16, 29, 373, 697, 847
MluCI	AATT	7 cut(s)	68, 119, 210, 415, 611, 626, 780
MlyI	GAGTC	2 cut(s)	439, 819
MroXI	GAANNNNTTC	1 cut(s)	665
MseI	TTAA	2 cut(s)	224, 783
MslI	CAYNNNNRTG	2 cut(s)	474, 546
MwoI	GCNNNNNNNGC	3 cut(s)	488, 527, 654
NdeII	GATC	3 cut(s)	103, 289, 301
NlaIII	CATG	3 cut(s)	204, 611, 697
NlaIV	GGNNCC	1 cut(s)	588
PdmI	GAANNNNTTC	1 cut(s)	665
PfeI	GAWTC	1 cut(s)	256
PkrI	GCNGC	7 cut(s)	199, 276, 493, 523, 526, 529, 738
PleI	GAGTC	2 cut(s)	438, 818
PpsI	GAGTC	2 cut(s)	438, 818
PpuMI	RGGWCCY	1 cut(s)	587
Psp5II	RGGWCCY	1 cut(s)	587
PspN4I	GGNNCC	1 cut(s)	588
PspPI	GGNCC	1 cut(s)	587
PspPPI	RGGWCCY	1 cut(s)	587
RsaI	GTAC	2 cut(s)	171, 296
RsaNI	GTAC	2 cut(s)	170, 295
RseI	CAYNNNNRTG	2 cut(s)	474, 546
SaqAI	TTAA	2 cut(s)	224, 783
SatI	GCNGC	7 cut(s)	198, 275, 492, 522, 525, 528, 737
Sau3AI	GATC	3 cut(s)	103, 289, 301
Sau96I	GGNCC	1 cut(s)	587
SchI	GAGTC	2 cut(s)	439, 819
SetI	ASST	4 cut(s)	171, 269, 443, 804
SfaNI	GCATC	4 cut(s)	161, 418, 625, 723
SfcI	CTRYAG	1 cut(s)	769
SinI	GGWCC	1 cut(s)	587
SmiMI	CAYNNNNRTG	2 cut(s)	474, 546
SmlI	CTYRAG	1 cut(s)	795
SmoI	CTYRAG	1 cut(s)	795
Sse9I	AATT	7 cut(s)	68, 119, 210, 415, 611, 626, 780
SsiI	CCGC	2 cut(s)	247, 560
SspMI	CTAG	1 cut(s)	557
TaaI	ACNGT	4 cut(s)	79, 356, 473, 602
TaiI	ACGT	1 cut(s)	269
TaqI	TCGA	1 cut(s)	179
TasI	AATT	7 cut(s)	68, 119, 210, 415, 611, 626, 780
TatI	WGTACW	1 cut(s)	294
TfiI	GAWTC	1 cut(s)	256
Tru1I	TTAA	2 cut(s)	224, 783
Tru9I	TTAA	2 cut(s)	224, 783
TscAI	CASTG	3 cut(s)	350, 476, 655
TseI	GCWGC	7 cut(s)	197, 274, 491, 521, 524, 527, 736
TspDTI	ATGAA	3 cut(s)	17, 351, 624
TspGWI	ACGGA	2 cut(s)	547, 709
TspRI	CASTG	3 cut(s)	350, 476, 655
VpaK11BI	GGWCC	1 cut(s)	587
XapI	RAATTY	2 cut(s)	119, 611
XmnI	GAANNNNTTC	1 cut(s)	665
XspI	CTAG	1 cut(s)	557

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.