Rmu_sc0003369.1_g000009

Heavy-metal-associated domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003369.1
Physical Location & Seq
Forward (+)
21994 .. 23096
1103 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003369.1_g000009.1.cds

Sequence Viewer

Length: 927 bp
atggttccagaattagagaaacctcggattaccgagatacatgttcggatggattgtaatgggtgtgtacagaagattaagaaagcactacatggcatcaacggtatatatgatctctacattgacttctctcagcaaaagttaacaataatagggtgggcggatccagagaagatagtaaaagccattaaaaagacgaggaagattgccaccatatgttcccatatagaacaaccaacagagcctgcttctcctccagcagaacaaccccccgaaggtgccgcagcaccacctcccgatgcagcaaaccttcctccaacagaatcacctcatccaccagccgaaccagctccaccacctgaagctgccccaccagccgagccaccaaaggatccgccaccaccggaacatccacaaccagaggcactaccaacacctgtggctgctgagaccaatctaggccaacaacatccggtgtaccaccacaggccaagagaagttggggaagttcataccatataccaccacccacctgattatggctacagatacggctaccctaatggctaccccggctactataacagataccataatagtcaaggacctccaccggaaccaactcctccccccgccccggctccggcccctgctccagctccggctccggctccagctcaggttccagtccatacaccaccggtctatgtgacacatagctacaacacatacaggccatcaccttatgtcactgaatatgagtatgttcagccacccccaccacaacagacgcattacagtaggatcagccaataccaccactacaatgaggatcaaccgtatcacaatatcagcaatggaaatggaaatggcaacatcacgtcgatttttagcgacgaaaatccgaatgcgtgtgctgtaatgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

308

Amino Acids

33.91

Weight (kDa)

5.87

Isoelectric Point (pI)

69.48

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0015599)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 278
AciI CCGC 4 cut(s) 161, 282, 395, 633
AclWI GGATC 6 cut(s) 158, 171, 386, 399, 812, 840
AcuI CTGAAG 1 cut(s) 381
AfaI GTAC 2 cut(s) 69, 479
AfiI CCNNNNNNNGG 4 cut(s) 275, 539, 637, 643
AflIII ACRYGT 1 cut(s) 40
AgeI ACCGGT 1 cut(s) 700
AjiI CACGTC 1 cut(s) 882
AluBI AGCT 5 cut(s) 350, 365, 659, 677, 720
AluI AGCT 5 cut(s) 350, 365, 659, 677, 720
Alw26I GTCTC 1 cut(s) 443
AlwI GGATC 6 cut(s) 158, 171, 386, 399, 812, 840
AlwNI CAGNNNCTG 1 cut(s) 245
AoxI GGCC 4 cut(s) 460, 488, 645, 734
ApeKI GCWGC 4 cut(s) 284, 302, 365, 443
AsiGI ACCGGT 1 cut(s) 700
AspS9I GGNCC 2 cut(s) 605, 646
AsuC2I CCSGG 2 cut(s) 573, 638
AsuHPI GGTGA 2 cut(s) 318, 732
AvaII GGWCC 1 cut(s) 605
BamHI GGATCC 2 cut(s) 163, 391
BanI GGYRCC 1 cut(s) 278
BbvI GCAGC 4 cut(s) 296, 314, 352, 430
BccI CCATC 2 cut(s) 43, 745
BceAI ACGGC 1 cut(s) 568
BcnI CCSGG 2 cut(s) 573, 638
BcoDI GTCTC 1 cut(s) 443
BfaI CTAG 1 cut(s) 458
BfmI CTRYAG 1 cut(s) 544
BisI GCNGC 5 cut(s) 282, 285, 303, 366, 444
BlsI GCNGC 5 cut(s) 283, 286, 304, 367, 445
Bme1390I CCNGG 2 cut(s) 573, 638
Bme18I GGWCC 1 cut(s) 605
BmgBI CACGTC 1 cut(s) 882
BmgT120I GGNCC 2 cut(s) 605, 646
BmrFI CCNGG 2 cut(s) 573, 638
BmsI GCATC 2 cut(s) 105, 289
BpmI CTGGAG 3 cut(s) 240, 639, 657
Bpu10I CCTNAGC 1 cut(s) 678
BpuMI CCSGG 2 cut(s) 573, 638
BsaI GGTCTC 1 cut(s) 443
BsaJI CCNNGG 3 cut(s) 23, 571, 636
BsaWI WCCGGW 4 cut(s) 403, 472, 613, 700
Bsc4I CCNNNNNNNGG 4 cut(s) 275, 539, 637, 643
Bse118I RCCGGY 1 cut(s) 700
Bse1I ACTGG 1 cut(s) 686
Bse3DI GCAATG 1 cut(s) 862
BseDI CCNNGG 3 cut(s) 23, 571, 636
BseGI GGATG 4 cut(s) 54, 331, 409, 469
BseLI CCNNNNNNNGG 4 cut(s) 275, 539, 637, 643
BseMI GCAATG 1 cut(s) 862
BseMII CTCAG 3 cut(s) 146, 438, 692
BseNI ACTGG 1 cut(s) 686
BseRI GAGGAG 2 cut(s) 243, 615
BseXI GCAGC 4 cut(s) 296, 314, 352, 430
BshFI GGCC 4 cut(s) 462, 490, 647, 736
BshNI GGYRCC 1 cut(s) 278
BshTI ACCGGT 1 cut(s) 700
BsiSI CCGG 9 cut(s) 404, 473, 573, 614, 638, 644, 662, 668, 701
BslI CCNNNNNNNGG 4 cut(s) 275, 539, 637, 643
BsmAI GTCTC 1 cut(s) 443
BsmI GAATGC 1 cut(s) 913
BsnI GGCC 4 cut(s) 462, 490, 647, 736
Bso31I GGTCTC 1 cut(s) 443
Bsp1407I TGTACA 1 cut(s) 67
Bsp143I GATC 5 cut(s) 112, 163, 391, 804, 832
BspACI CCGC 4 cut(s) 161, 282, 395, 633
BspANI GGCC 4 cut(s) 462, 490, 647, 736
BspCNI CTCAG 3 cut(s) 145, 439, 691
BspPI GGATC 6 cut(s) 158, 171, 386, 399, 812, 840
BspT107I GGYRCC 1 cut(s) 278
BspTNI GGTCTC 1 cut(s) 443
BsrDI GCAATG 1 cut(s) 862
BsrFI RCCGGY 1 cut(s) 700
BsrGI TGTACA 1 cut(s) 67
BsrI ACTGG 1 cut(s) 686
BssAI RCCGGY 1 cut(s) 700
BssECI CCNNGG 3 cut(s) 23, 571, 636
BssMI GATC 5 cut(s) 112, 163, 391, 804, 832
Bst4CI ACNGT 3 cut(s) 104, 800, 840
BstAUI TGTACA 1 cut(s) 67
BstC8I GCNNGC 1 cut(s) 246
BstDEI CTNAG 3 cut(s) 132, 447, 678
BstF5I GGATG 4 cut(s) 54, 331, 409, 469
BstKTI GATC 5 cut(s) 115, 166, 394, 807, 835
BstMAI GTCTC 1 cut(s) 443
BstMBI GATC 5 cut(s) 112, 163, 391, 804, 832
BstMWI GCNNNNNNNGC 3 cut(s) 347, 374, 573
BstNSI RCATGY 1 cut(s) 44
BstSCI CCNGG 2 cut(s) 571, 636
BstSFI CTRYAG 1 cut(s) 544
BstV1I GCAGC 4 cut(s) 296, 314, 352, 430
BstX2I RGATCY 2 cut(s) 163, 391
BstYI RGATCY 2 cut(s) 163, 391
BsuRI GGCC 4 cut(s) 462, 490, 647, 736
BtrI CACGTC 1 cut(s) 882
BtsCI GGATG 4 cut(s) 54, 331, 409, 469
BtsIMutI CAGTG 1 cut(s) 750
Cac8I GCNNGC 1 cut(s) 246
CaiI CAGNNNCTG 1 cut(s) 245
Cfr10I RCCGGY 1 cut(s) 700
Cfr13I GGNCC 2 cut(s) 605, 646
CseI GACGC 1 cut(s) 799
Csp6I GTAC 2 cut(s) 68, 478
CspAI ACCGGT 1 cut(s) 700
CspCI CAANNNNNGTGG 2 cut(s) 420, 455
CviAII CATG 2 cut(s) 41, 92
CviQI GTAC 2 cut(s) 68, 478
DdeI CTNAG 3 cut(s) 132, 447, 678
DpnI GATC 5 cut(s) 114, 165, 393, 806, 834
DpnII GATC 5 cut(s) 112, 163, 391, 804, 832
EciI GGCGGA 2 cut(s) 176, 384
Eco31I GGTCTC 1 cut(s) 443
Eco47I GGWCC 1 cut(s) 605
Eco57I CTGAAG 1 cut(s) 381
EcoO109I RGGNCCY 1 cut(s) 605
FaeI CATG 2 cut(s) 44, 95
FatI CATG 2 cut(s) 40, 91
FauI CCCGC 1 cut(s) 640
FauNDI CATATG 1 cut(s) 215
Fnu4HI GCNGC 5 cut(s) 282, 285, 303, 366, 444
FokI GGATG 4 cut(s) 61, 318, 396, 456
Fsp4HI GCNGC 5 cut(s) 282, 285, 303, 366, 444
FspBI CTAG 1 cut(s) 458
GluI GCNGC 5 cut(s) 282, 285, 303, 366, 444
GsuI CTGGAG 3 cut(s) 240, 639, 657
HaeIII GGCC 4 cut(s) 462, 490, 647, 736
HapII CCGG 9 cut(s) 404, 473, 573, 614, 638, 644, 662, 668, 701
HgaI GACGC 1 cut(s) 799
Hin1II CATG 2 cut(s) 44, 95
HincII GTYRAC 1 cut(s) 144
HindII GTYRAC 1 cut(s) 144
HinfI GANTC 1 cut(s) 323
HpaI GTTAAC 1 cut(s) 144
HpaII CCGG 9 cut(s) 404, 473, 573, 614, 638, 644, 662, 668, 701
HphI GGTGA 2 cut(s) 318, 732
Hpy166II GTNNAC 3 cut(s) 68, 144, 478
Hpy188I TCNGA 3 cut(s) 27, 48, 906
Hpy188III TCNNGA 3 cut(s) 8, 167, 296
Hpy8I GTNNAC 3 cut(s) 68, 144, 478
Hpy99I CGWCG 2 cut(s) 886, 899
HpyAV CCTTC 2 cut(s) 269, 320
HpyCH4III ACNGT 3 cut(s) 104, 800, 840
HpyCH4IV ACGT 1 cut(s) 881
HpyCH4V TGCA 1 cut(s) 302
HpyF10VI GCNNNNNNNGC 3 cut(s) 347, 374, 573
HpyF3I CTNAG 3 cut(s) 132, 447, 678
HpySE526I ACGT 1 cut(s) 881
Hsp92II CATG 2 cut(s) 44, 95
KspAI GTTAAC 1 cut(s) 144
Kzo9I GATC 5 cut(s) 112, 163, 391, 804, 832
LmnI GCTCC 6 cut(s) 355, 646, 658, 664, 670, 676
Lsp1109I GCAGC 4 cut(s) 296, 314, 352, 430
LweI GCATC 2 cut(s) 105, 289
MaeI CTAG 1 cut(s) 458
MaeII ACGT 1 cut(s) 881
MaeIII GTNAC 2 cut(s) 709, 748
MalI GATC 5 cut(s) 114, 165, 393, 806, 834
MboI GATC 5 cut(s) 112, 163, 391, 804, 832
MboII GAAGA 3 cut(s) 85, 184, 214
MflI RGATCY 2 cut(s) 163, 391
MluCI AATT 1 cut(s) 11
MmeI TCCRAC 1 cut(s) 341
MseI TTAA 3 cut(s) 78, 143, 189
MslI CAYNNNNRTG 1 cut(s) 825
MspI CCGG 9 cut(s) 404, 473, 573, 614, 638, 644, 662, 668, 701
MspR9I CCNGG 2 cut(s) 573, 638
Mva1269I GAATGC 1 cut(s) 913
MwoI GCNNNNNNNGC 3 cut(s) 347, 374, 573
NciI CCSGG 2 cut(s) 573, 638
NdeI CATATG 1 cut(s) 215
NdeII GATC 5 cut(s) 112, 163, 391, 804, 832
NlaIII CATG 2 cut(s) 44, 95
NmeAIII GCCGAG 1 cut(s) 403
NmuCI GTSAC 2 cut(s) 709, 748
NspI RCATGY 1 cut(s) 44
PciI ACATGT 1 cut(s) 40
PctI GAATGC 1 cut(s) 913
PfeI GAWTC 1 cut(s) 323
PinAI ACCGGT 1 cut(s) 700
PkrI GCNGC 5 cut(s) 283, 286, 304, 367, 445
PpuMI RGGWCCY 1 cut(s) 605
PscI ACATGT 1 cut(s) 40
Psp5II RGGWCCY 1 cut(s) 605
PspPI GGNCC 2 cut(s) 605, 646
PspPPI RGGWCCY 1 cut(s) 605
PstNI CAGNNNCTG 1 cut(s) 245
PsuI RGATCY 2 cut(s) 163, 391
RsaI GTAC 2 cut(s) 69, 479
RsaNI GTAC 2 cut(s) 68, 478
RseI CAYNNNNRTG 1 cut(s) 825
SaqAI TTAA 3 cut(s) 78, 143, 189
SatI GCNGC 5 cut(s) 282, 285, 303, 366, 444
Sau3AI GATC 5 cut(s) 112, 163, 391, 804, 832
Sau96I GGNCC 2 cut(s) 605, 646
ScrFI CCNGG 2 cut(s) 573, 638
SfaNI GCATC 2 cut(s) 105, 289
SfcI CTRYAG 1 cut(s) 544
SinI GGWCC 1 cut(s) 605
SmiMI CAYNNNNRTG 1 cut(s) 825
Sse9I AATT 1 cut(s) 11
SsiI CCGC 4 cut(s) 161, 282, 395, 633
SspMI CTAG 1 cut(s) 458
StyD4I CCNGG 2 cut(s) 571, 636
TaaI ACNGT 3 cut(s) 104, 800, 840
TaiI ACGT 1 cut(s) 884
TaqI TCGA 1 cut(s) 884
TasI AATT 1 cut(s) 11
TatI WGTACW 1 cut(s) 67
TauI GCSGC 1 cut(s) 284
TfiI GAWTC 1 cut(s) 323
Tru1I TTAA 3 cut(s) 78, 143, 189
Tru9I TTAA 3 cut(s) 78, 143, 189
TscAI CASTG 1 cut(s) 757
TseFI GTSAC 2 cut(s) 709, 748
TseI GCWGC 4 cut(s) 284, 302, 365, 443
Tsp45I GTSAC 2 cut(s) 709, 748
TspDTI ATGAA 1 cut(s) 500
TspRI CASTG 1 cut(s) 757
VpaK11BI GGWCC 1 cut(s) 605
XceI RCATGY 1 cut(s) 44
XspI CTAG 1 cut(s) 458
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.