Rmu_sc0003427.1_g000005

2Fe-2S iron-sulfur cluster binding domain

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003427.1
Physical Location & Seq
Forward (+)
26505 .. 27872
1368 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003427.1_g000005.1.cds

Sequence Viewer

Length: 594 bp
atgggtactctccagttgagctcttgtggttcatcattttgctcacccatcccttctaacctgatcaatcacaacattaccacctcccattcaactcccaagtccctcactttctccggagggaaaataagagcagttagcacagctccaaatagtagtgaatctgcacaagccattgaaccagaacaacaacctcctctggttgattttgcatttgttaactctgtgttgctacctgatcaaaccccggatgtgcatcttcgtcaagcctgtggaggacagaagcttaggagtataatgttggatggaaatattgaattgtatggaccatatgctagacctctgctgaattgtggtggtggaggaacctgtggaacatgtatggtggaggttattaaaggaaaggagctcttgagccctcggacagacaaagaaaagaaacaccttcaaaagaaaccaaagaattggagacttgcttgccaagccacagtagggaaacctgactccagggggctggttgttgttcaacaactacctgaatggaaagcacatgaatggaagtatgaggacaccctagtgaacccttcacagtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

197

Amino Acids

21.41

Weight (kDa)

8.68

Isoelectric Point (pI)

53.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013153)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccIII TCCGGA 1 cut(s) 116
AfaI GTAC 1 cut(s) 7
AfiI CCNNNNNNNGG 1 cut(s) 492
AflIII ACRYGT 1 cut(s) 377
AgsI TTSAA 5 cut(s) 93, 179, 317, 449, 527
AjnI CCWGG 1 cut(s) 506
AleI CACNNNNGTG 1 cut(s) 575
AluBI AGCT 4 cut(s) 21, 146, 286, 409
AluI AGCT 4 cut(s) 21, 146, 286, 409
Alw21I GWGCWC 2 cut(s) 23, 411
Alw26I GTCTC 1 cut(s) 463
Aor13HI TCCGGA 1 cut(s) 116
AspS9I GGNCC 1 cut(s) 326
AsuC2I CCSGG 1 cut(s) 248
AsuHPI GGTGA 1 cut(s) 36
AvaII GGWCC 1 cut(s) 326
BanII GRGCYC 3 cut(s) 23, 411, 419
Bbv12I GWGCWC 2 cut(s) 23, 411
BccI CCATC 2 cut(s) 56, 299
BciT130I CCWGG 1 cut(s) 508
BclI TGATCA 2 cut(s) 63, 238
BcnI CCSGG 1 cut(s) 248
BcoDI GTCTC 1 cut(s) 463
BfaI CTAG 2 cut(s) 336, 575
Bme1390I CCNGG 2 cut(s) 248, 508
Bme18I GGWCC 1 cut(s) 326
BmgT120I GGNCC 1 cut(s) 326
BmiI GGNNCC 1 cut(s) 367
BmrFI CCNGG 2 cut(s) 248, 508
BmsI GCATC 1 cut(s) 265
BpmI CTGGAG 1 cut(s) 490
Bpu10I CCTNAGC 1 cut(s) 287
BpuEI CTTGAG 1 cut(s) 433
BpuMI CCSGG 1 cut(s) 248
BsaBI GATNNNNATC 1 cut(s) 255
BsaJI CCNNGG 3 cut(s) 246, 419, 507
BsaWI WCCGGW 1 cut(s) 116
Bsc4I CCNNNNNNNGG 1 cut(s) 492
Bse1I ACTGG 1 cut(s) 13
Bse8I GATNNNNATC 1 cut(s) 255
BseAI TCCGGA 1 cut(s) 116
BseBI CCWGG 1 cut(s) 508
BseDI CCNNGG 3 cut(s) 246, 419, 507
BseGI GGATG 3 cut(s) 48, 256, 310
BseJI GATNNNNATC 1 cut(s) 255
BseLI CCNNNNNNNGG 1 cut(s) 492
BseNI ACTGG 1 cut(s) 13
BseRI GAGGAG 1 cut(s) 186
BsgI GTGCAG 1 cut(s) 150
BsiHKAI GWGCWC 2 cut(s) 23, 411
BsiSI CCGG 2 cut(s) 117, 248
BslFI GGGAC 1 cut(s) 88
BslI CCNNNNNNNGG 1 cut(s) 492
BsmAI GTCTC 1 cut(s) 463
BsmFI GGGAC 1 cut(s) 88
Bsp1286I GDGCHC 3 cut(s) 23, 411, 419
Bsp13I TCCGGA 1 cut(s) 116
Bsp143I GATC 2 cut(s) 63, 238
BspEI TCCGGA 1 cut(s) 116
BspLI GGNNCC 1 cut(s) 367
BsrI ACTGG 1 cut(s) 13
BssECI CCNNGG 3 cut(s) 246, 419, 507
BssMI GATC 2 cut(s) 63, 238
Bst2UI CCWGG 1 cut(s) 508
Bst4CI ACNGT 2 cut(s) 490, 591
BstC8I GCNNGC 1 cut(s) 478
BstDEI CTNAG 1 cut(s) 287
BstF5I GGATG 3 cut(s) 48, 256, 310
BstKTI GATC 2 cut(s) 66, 241
BstMAI GTCTC 1 cut(s) 463
BstMBI GATC 2 cut(s) 63, 238
BstMWI GCNNNNNNNGC 1 cut(s) 482
BstNI CCWGG 1 cut(s) 508
BstNSI RCATGY 1 cut(s) 381
BstSCI CCNGG 2 cut(s) 246, 506
BstXI CCANNNNNNTGG 2 cut(s) 465, 514
BtsCI GGATG 3 cut(s) 48, 256, 310
Cac8I GCNNGC 1 cut(s) 478
Cfr13I GGNCC 1 cut(s) 326
Csp6I GTAC 1 cut(s) 6
CviAII CATG 2 cut(s) 378, 551
CviJI RGCY 9 cut(s) 21, 146, 173, 269, 286, 409, 417, 485, 514
CviKI_1 RGCY 9 cut(s) 21, 146, 173, 269, 286, 409, 417, 485, 514
CviQI GTAC 1 cut(s) 6
DdeI CTNAG 1 cut(s) 287
DpnI GATC 2 cut(s) 65, 240
DpnII GATC 2 cut(s) 63, 238
Ecl136II GAGCTC 2 cut(s) 21, 409
Eco24I GRGCYC 3 cut(s) 23, 411, 419
Eco47I GGWCC 1 cut(s) 326
Eco53kI GAGCTC 2 cut(s) 21, 409
EcoICRI GAGCTC 2 cut(s) 21, 409
EcoRII CCWGG 1 cut(s) 506
EcoT38I GRGCYC 3 cut(s) 23, 411, 419
FaeI CATG 2 cut(s) 381, 554
FaiI YATR 8 cut(s) 296, 324, 331, 333, 379, 383, 552, 564
FalI AAGNNNNNCTT 2 cut(s) 395, 427
FaqI GGGAC 1 cut(s) 88
FatI CATG 2 cut(s) 377, 550
FauNDI CATATG 1 cut(s) 331
FbaI TGATCA 2 cut(s) 63, 238
FokI GGATG 3 cut(s) 35, 263, 317
FriOI GRGCYC 3 cut(s) 23, 411, 419
FspBI CTAG 2 cut(s) 336, 575
GsuI CTGGAG 1 cut(s) 490
HapII CCGG 2 cut(s) 117, 248
Hin1II CATG 2 cut(s) 381, 554
HincII GTYRAC 1 cut(s) 220
HindII GTYRAC 1 cut(s) 220
HindIII AAGCTT 1 cut(s) 284
HinfI GANTC 2 cut(s) 161, 503
HpaI GTTAAC 1 cut(s) 220
HpaII CCGG 2 cut(s) 117, 248
HphI GGTGA 1 cut(s) 36
Hpy166II GTNNAC 2 cut(s) 220, 580
Hpy188I TCNGA 1 cut(s) 423
Hpy188III TCNNGA 2 cut(s) 117, 412
Hpy8I GTNNAC 2 cut(s) 220, 580
HpyAV CCTTC 3 cut(s) 63, 455, 594
HpyCH4III ACNGT 2 cut(s) 490, 591
HpyCH4V TGCA 3 cut(s) 167, 212, 256
HpyF10VI GCNNNNNNNGC 1 cut(s) 482
HpyF3I CTNAG 1 cut(s) 287
Hsp92II CATG 2 cut(s) 381, 554
Kpn2I TCCGGA 1 cut(s) 116
Ksp22I TGATCA 2 cut(s) 63, 238
KspAI GTTAAC 1 cut(s) 220
Kzo9I GATC 2 cut(s) 63, 238
LmnI GCTCC 2 cut(s) 151, 406
LweI GCATC 1 cut(s) 265
MaeI CTAG 2 cut(s) 336, 575
MalI GATC 2 cut(s) 65, 240
MboI GATC 2 cut(s) 63, 238
MboII GAAGA 1 cut(s) 251
MhlI GDGCHC 3 cut(s) 23, 411, 419
MluCI AATT 3 cut(s) 317, 349, 463
MlyI GAGTC 1 cut(s) 497
MmeI TCCRAC 1 cut(s) 282
MroI TCCGGA 1 cut(s) 116
MseI TTAA 2 cut(s) 219, 396
MslI CAYNNNNRTG 2 cut(s) 553, 575
MspI CCGG 2 cut(s) 117, 248
MspR9I CCNGG 2 cut(s) 248, 508
MvaI CCWGG 1 cut(s) 508
MwoI GCNNNNNNNGC 1 cut(s) 482
NciI CCSGG 1 cut(s) 248
NdeI CATATG 1 cut(s) 331
NdeII GATC 2 cut(s) 63, 238
NlaIII CATG 2 cut(s) 381, 554
NlaIV GGNNCC 1 cut(s) 367
NspI RCATGY 1 cut(s) 381
OliI CACNNNNGTG 1 cut(s) 575
PciI ACATGT 1 cut(s) 377
PfeI GAWTC 1 cut(s) 161
PleI GAGTC 1 cut(s) 497
PpsI GAGTC 1 cut(s) 497
PscI ACATGT 1 cut(s) 377
Psp124BI GAGCTC 2 cut(s) 23, 411
Psp6I CCWGG 1 cut(s) 506
PspGI CCWGG 1 cut(s) 506
PspN4I GGNNCC 1 cut(s) 367
PspPI GGNCC 1 cut(s) 326
RsaI GTAC 1 cut(s) 7
RsaNI GTAC 1 cut(s) 6
RseI CAYNNNNRTG 2 cut(s) 553, 575
SacI GAGCTC 2 cut(s) 23, 411
SaqAI TTAA 2 cut(s) 219, 396
Sau3AI GATC 2 cut(s) 63, 238
Sau96I GGNCC 1 cut(s) 326
SchI GAGTC 1 cut(s) 497
ScrFI CCNGG 2 cut(s) 248, 508
SduI GDGCHC 3 cut(s) 23, 411, 419
SfaNI GCATC 1 cut(s) 265
SinI GGWCC 1 cut(s) 326
SmiMI CAYNNNNRTG 2 cut(s) 553, 575
SmlI CTYRAG 1 cut(s) 412
SmoI CTYRAG 1 cut(s) 412
Sse9I AATT 3 cut(s) 317, 349, 463
SspI AATATT 1 cut(s) 313
SspMI CTAG 2 cut(s) 336, 575
SstI GAGCTC 2 cut(s) 23, 411
StyD4I CCNGG 2 cut(s) 246, 506
TaaI ACNGT 2 cut(s) 490, 591
TasI AATT 3 cut(s) 317, 349, 463
TfiI GAWTC 1 cut(s) 161
Tru1I TTAA 2 cut(s) 219, 396
Tru9I TTAA 2 cut(s) 219, 396
TspDTI ATGAA 2 cut(s) 21, 567
VpaK11BI GGWCC 1 cut(s) 326
XceI RCATGY 1 cut(s) 381
XspI CTAG 2 cut(s) 336, 575
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.