Rmu_sc0003804.1_g000025

Belongs to the UDP-glycosyltransferase family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003804.1
Physical Location & Seq
Forward (+)
81512 .. 81790
279 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003804.1_g000025.1.cds

Sequence Viewer

Length: 279 bp
atgttgttgacggaggagctaggggtggcggttcggtcaaagataccgccgtggaagaacgtggtggagagagaagagatagaggaaatggtgaggaaaattatggagggcaaggaaggttttgcattgagagatagagccaagaatcttaaattcagtggtgcaaaagttttggaacaaggtcgttcgtcttatgatgctctttctcagttcactaaacatgctgaaatgttcgtgcaatttgcaaatggtgttgatcctccttcccaagttccgtga

Protein Analysis

92

Amino Acids

10.42

Weight (kDa)

6.59

Isoelectric Point (pI)

47.74

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018541)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 29, 47
AclWI GGATC 1 cut(s) 251
AcsI RAATTY 1 cut(s) 152
AluBI AGCT 1 cut(s) 19
AluI AGCT 1 cut(s) 19
AlwI GGATC 1 cut(s) 251
ApoI RAATTY 1 cut(s) 152
AsuHPI GGTGA 1 cut(s) 103
BaeI ACNNNNGTAYC 2 cut(s) 35, 68
BceAI ACGGC 1 cut(s) 34
BfaI CTAG 1 cut(s) 20
BmsI GCATC 1 cut(s) 187
BsaJI CCNNGG 1 cut(s) 50
BseDI CCNNGG 1 cut(s) 50
BseMII CTCAG 1 cut(s) 221
BseRI GAGGAG 1 cut(s) 29
Bsp143I GATC 1 cut(s) 256
BspACI CCGC 2 cut(s) 29, 47
BspCNI CTCAG 1 cut(s) 220
BspPI GGATC 1 cut(s) 251
BssECI CCNNGG 1 cut(s) 50
BssMI GATC 1 cut(s) 256
Bst6I CTCTTC 1 cut(s) 69
BstDEI CTNAG 1 cut(s) 207
BstDSI CCRYGG 1 cut(s) 50
BstKTI GATC 1 cut(s) 259
BstMBI GATC 1 cut(s) 256
BstNSI RCATGY 1 cut(s) 224
BtgI CCRYGG 1 cut(s) 50
BtsIMutI CAGTG 1 cut(s) 163
CviAII CATG 1 cut(s) 221
CviJI RGCY 2 cut(s) 19, 140
CviKI_1 RGCY 2 cut(s) 19, 140
DdeI CTNAG 1 cut(s) 207
DpnI GATC 1 cut(s) 258
DpnII GATC 1 cut(s) 256
Eam1104I CTCTTC 1 cut(s) 69
EarI CTCTTC 1 cut(s) 69
FaeI CATG 1 cut(s) 224
FaiI YATR 3 cut(s) 104, 195, 222
FatI CATG 1 cut(s) 220
FspBI CTAG 1 cut(s) 20
Hin1II CATG 1 cut(s) 224
HincII GTYRAC 1 cut(s) 9
HindII GTYRAC 1 cut(s) 9
HinfI GANTC 1 cut(s) 145
HphI GGTGA 1 cut(s) 103
Hpy166II GTNNAC 2 cut(s) 9, 213
Hpy8I GTNNAC 2 cut(s) 9, 213
HpyAV CCTTC 2 cut(s) 110, 273
HpyCH4IV ACGT 1 cut(s) 60
HpyCH4V TGCA 4 cut(s) 125, 164, 238, 245
HpyF3I CTNAG 1 cut(s) 207
HpySE526I ACGT 1 cut(s) 60
Hsp92II CATG 1 cut(s) 224
Kzo9I GATC 1 cut(s) 256
LmnI GCTCC 1 cut(s) 16
LweI GCATC 1 cut(s) 187
MaeI CTAG 1 cut(s) 20
MaeII ACGT 1 cut(s) 60
MalI GATC 1 cut(s) 258
MboI GATC 1 cut(s) 256
MboII GAAGA 2 cut(s) 67, 86
MluCI AATT 3 cut(s) 99, 152, 239
MnlI CCTC 5 cut(s) 7, 76, 87, 100, 270
MseI TTAA 1 cut(s) 150
NdeII GATC 1 cut(s) 256
NlaIII CATG 1 cut(s) 224
NspI RCATGY 1 cut(s) 224
PfeI GAWTC 1 cut(s) 145
SaqAI TTAA 1 cut(s) 150
Sau3AI GATC 1 cut(s) 256
SetI ASST 4 cut(s) 21, 63, 121, 184
SfaNI GCATC 1 cut(s) 187
SgeI CNNG 8 cut(s) 32, 63, 73, 124, 154, 191, 233, 247
Sse9I AATT 3 cut(s) 99, 152, 239
SsiI CCGC 2 cut(s) 29, 47
SspMI CTAG 1 cut(s) 20
TaiI ACGT 1 cut(s) 63
TaqII GACCGA 1 cut(s) 24
TasI AATT 3 cut(s) 99, 152, 239
TfiI GAWTC 1 cut(s) 145
Tru1I TTAA 1 cut(s) 150
Tru9I TTAA 1 cut(s) 150
TscAI CASTG 1 cut(s) 163
TspGWI ACGGA 2 cut(s) 26, 264
TspRI CASTG 1 cut(s) 163
XapI RAATTY 1 cut(s) 152
XceI RCATGY 1 cut(s) 224
XspI CTAG 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.