Rmu_sc0003874.1_g000012

Involved in transport from the ER to the Golgi apparatus as well as in intra-Golgi transport. It belongs to a super-family of proteins called t-SNAREs or soluble NSF (N-ethylmaleimide- sensitive factor) attachment protein receptor

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003874.1
Physical Location & Seq
Reverse (-)
50943 .. 53764
2822 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0003874.1_g000012.1.cds

Sequence Viewer

Length: 687 bp
atgaattcttatcgtaagtttgtctctgcaaagggttctgtcaaatttgatgctgctgataatgatcttgaatctgggatagatcgactattaaagcaactccaacaagtaaatttacagatgcaagcatgggtatcatcaggaggatcagaaatggtttctcataccttgactagacatcaagagattcttcaagatctcactcaggaattttatcgtctccgctccagccttagagctaagcaggagcacgcttcactacttgaggattttagggagtttgatcgaacaagagttgacttggaagctggtggagattctgcaggaaacgctctcctgaaagaacatgcttctgttagccgaagtacaggacagatggatactgtgatctctcaagctcaagcaactctgggtgcacttgtccttcaacgttcaacatttggcggtattaactcaaagctcagcaacattggcagccgcctcccaacggtaagtcacatcctttctgcaataaagcgtaaaaagtctatggataccatcattctttcacttgtcgcatcagtgtgcacatttctcatatttatctactggtacagtagtggtgtgaggttgggggcatggggtgagcttttggggttttgggcaggtgtgcggttggcgatttcttcgtttgctggtaagaattaa

Protein Analysis

228

Amino Acids

25.13

Weight (kDa)

9.44

Isoelectric Point (pI)

42.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0011955)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 635
Acc36I ACCTGC 1 cut(s) 635
AccBSI CCGCTC 1 cut(s) 225
AciI CCGC 4 cut(s) 223, 444, 478, 652
AclI AACGTT 1 cut(s) 430
AclWI GGATC 1 cut(s) 154
AcsI RAATTY 4 cut(s) 4, 44, 112, 209
AfaI GTAC 2 cut(s) 367, 593
AfiI CCNNNNNNNGG 1 cut(s) 487
AgsI TTSAA 4 cut(s) 71, 194, 428, 435
AluBI AGCT 5 cut(s) 239, 308, 398, 460, 628
AluI AGCT 5 cut(s) 239, 308, 398, 460, 628
Alw21I GWGCWC 3 cut(s) 252, 418, 569
Alw26I GTCTC 2 cut(s) 28, 224
Alw44I GTGCAC 2 cut(s) 414, 565
AlwI GGATC 1 cut(s) 154
ApaLI GTGCAC 2 cut(s) 414, 565
ApeKI GCWGC 2 cut(s) 53, 474
ApoI RAATTY 4 cut(s) 4, 44, 112, 209
AsuHPI GGTGA 1 cut(s) 635
BaeGI GKGCMC 2 cut(s) 418, 569
BaeI ACNNNNGTAYC 2 cut(s) 583, 616
Bbv12I GWGCWC 3 cut(s) 252, 418, 569
BbvI GCAGC 2 cut(s) 40, 486
BccI CCATC 2 cut(s) 370, 545
BciVI GTATCC 2 cut(s) 373, 526
BcoDI GTCTC 2 cut(s) 28, 224
BfaI CTAG 1 cut(s) 174
BfmI CTRYAG 1 cut(s) 321
BfuAI ACCTGC 1 cut(s) 635
BfuI GTATCC 2 cut(s) 373, 526
BglII AGATCT 1 cut(s) 196
BisI GCNGC 3 cut(s) 54, 475, 478
BlpI GCTNAGC 2 cut(s) 240, 461
BlsI GCNGC 3 cut(s) 55, 476, 479
BmsI GCATC 3 cut(s) 40, 111, 566
BpmI CTGGAG 1 cut(s) 211
Bpu1102I GCTNAGC 2 cut(s) 240, 461
BpuEI CTTGAG 3 cut(s) 284, 378, 384
BsaBI GATNNNNATC 1 cut(s) 63
Bsc4I CCNNNNNNNGG 1 cut(s) 487
Bse1I ACTGG 1 cut(s) 593
Bse8I GATNNNNATC 1 cut(s) 63
BseGI GGATG 1 cut(s) 498
BseJI GATNNNNATC 1 cut(s) 63
BseLI CCNNNNNNNGG 1 cut(s) 487
BseMII CTCAG 2 cut(s) 218, 475
BseNI ACTGG 1 cut(s) 593
BseSI GKGCMC 2 cut(s) 418, 569
BseXI GCAGC 2 cut(s) 40, 486
BsiHKAI GWGCWC 3 cut(s) 252, 418, 569
BslI CCNNNNNNNGG 1 cut(s) 487
BsmAI GTCTC 2 cut(s) 28, 224
BsmBI CGTCTC 1 cut(s) 224
Bsp1286I GDGCHC 3 cut(s) 252, 418, 569
Bsp143I GATC 6 cut(s) 64, 82, 146, 196, 283, 387
Bsp1720I GCTNAGC 2 cut(s) 240, 461
BspACI CCGC 4 cut(s) 223, 444, 478, 652
BspCNI CTCAG 2 cut(s) 217, 474
BspMAI CTGCAG 1 cut(s) 325
BspMI ACCTGC 1 cut(s) 635
BspPI GGATC 1 cut(s) 154
BsrBI CCGCTC 1 cut(s) 225
BsrI ACTGG 1 cut(s) 593
BssMI GATC 6 cut(s) 64, 82, 146, 196, 283, 387
Bst4CI ACNGT 3 cut(s) 385, 490, 596
BstC8I GCNNGC 2 cut(s) 126, 252
BstDEI CTNAG 4 cut(s) 204, 233, 240, 461
BstF5I GGATG 1 cut(s) 498
BstKTI GATC 6 cut(s) 67, 85, 149, 199, 286, 390
BstMAI GTCTC 2 cut(s) 28, 224
BstMBI GATC 6 cut(s) 64, 82, 146, 196, 283, 387
BstMWI GCNNNNNNNGC 2 cut(s) 329, 471
BstNSI RCATGY 1 cut(s) 350
BstSFI CTRYAG 1 cut(s) 321
BstSLI GKGCMC 2 cut(s) 418, 569
BstV1I GCAGC 2 cut(s) 40, 486
BstX2I RGATCY 1 cut(s) 196
BstYI RGATCY 1 cut(s) 196
BsuI GTATCC 2 cut(s) 373, 526
BtsCI GGATG 1 cut(s) 498
BtsIMutI CAGTG 1 cut(s) 567
BveI ACCTGC 1 cut(s) 635
Cac8I GCNNGC 2 cut(s) 126, 252
Csp6I GTAC 2 cut(s) 366, 592
CviAII CATG 3 cut(s) 129, 347, 618
CviJI RGCY 8 cut(s) 231, 239, 308, 360, 398, 460, 477, 628
CviKI_1 RGCY 8 cut(s) 231, 239, 308, 360, 398, 460, 477, 628
CviQI GTAC 2 cut(s) 366, 592
DdeI CTNAG 4 cut(s) 204, 233, 240, 461
DpnI GATC 6 cut(s) 66, 84, 148, 198, 285, 389
DpnII GATC 6 cut(s) 64, 82, 146, 196, 283, 387
EcoRI GAATTC 1 cut(s) 4
Esp3I CGTCTC 1 cut(s) 224
FaeI CATG 3 cut(s) 132, 350, 621
FaiI YATR 6 cut(s) 130, 165, 348, 530, 578, 619
FalI AAGNNNNNCTT 2 cut(s) 174, 206
FatI CATG 3 cut(s) 128, 346, 617
Fnu4HI GCNGC 3 cut(s) 54, 475, 478
FokI GGATG 1 cut(s) 485
Fsp4HI GCNGC 3 cut(s) 54, 475, 478
FspBI CTAG 1 cut(s) 174
GluI GCNGC 3 cut(s) 54, 475, 478
GsuI CTGGAG 1 cut(s) 211
Hin1II CATG 3 cut(s) 132, 350, 621
HincII GTYRAC 1 cut(s) 298
HindII GTYRAC 1 cut(s) 298
HinfI GANTC 3 cut(s) 71, 187, 317
HphI GGTGA 1 cut(s) 635
Hpy166II GTNNAC 3 cut(s) 298, 416, 567
Hpy188I TCNGA 1 cut(s) 151
Hpy188III TCNNGA 6 cut(s) 68, 141, 182, 194, 206, 337
Hpy8I GTNNAC 3 cut(s) 298, 416, 567
HpyAV CCTTC 1 cut(s) 434
HpyCH4III ACNGT 3 cut(s) 385, 490, 596
HpyCH4IV ACGT 1 cut(s) 430
HpyCH4V TGCA 6 cut(s) 29, 124, 323, 416, 509, 567
HpyF10VI GCNNNNNNNGC 2 cut(s) 329, 471
HpyF3I CTNAG 4 cut(s) 204, 233, 240, 461
HpySE526I ACGT 1 cut(s) 430
Hsp92II CATG 3 cut(s) 132, 350, 621
Kzo9I GATC 6 cut(s) 64, 82, 146, 196, 283, 387
LmnI GCTCC 2 cut(s) 230, 247
Lsp1109I GCAGC 2 cut(s) 40, 486
LweI GCATC 3 cut(s) 40, 111, 566
MaeI CTAG 1 cut(s) 174
MaeII ACGT 1 cut(s) 430
MaeIII GTNAC 1 cut(s) 494
MalI GATC 6 cut(s) 66, 84, 148, 198, 285, 389
MbiI CCGCTC 1 cut(s) 225
MboI GATC 6 cut(s) 64, 82, 146, 196, 283, 387
MboII GAAGA 2 cut(s) 182, 657
MflI RGATCY 1 cut(s) 196
MhlI GDGCHC 3 cut(s) 252, 418, 569
MluCI AATT 5 cut(s) 4, 44, 112, 209, 682
MmeI TCCRAC 1 cut(s) 127
MnlI CCTC 4 cut(s) 137, 259, 491, 600
MseI TTAA 3 cut(s) 92, 450, 685
MslI CAYNNNNRTG 1 cut(s) 562
MwoI GCNNNNNNNGC 2 cut(s) 329, 471
NdeII GATC 6 cut(s) 64, 82, 146, 196, 283, 387
NlaIII CATG 3 cut(s) 132, 350, 621
NmuCI GTSAC 1 cut(s) 494
NspI RCATGY 1 cut(s) 350
PaqCI CACCTGC 1 cut(s) 635
PfeI GAWTC 3 cut(s) 71, 187, 317
PkrI GCNGC 3 cut(s) 55, 476, 479
Psp1406I AACGTT 1 cut(s) 430
PstI CTGCAG 1 cut(s) 325
PsuI RGATCY 1 cut(s) 196
RsaI GTAC 2 cut(s) 367, 593
RsaNI GTAC 2 cut(s) 366, 592
RseI CAYNNNNRTG 1 cut(s) 562
SaqAI TTAA 3 cut(s) 92, 450, 685
SatI GCNGC 3 cut(s) 54, 475, 478
Sau3AI GATC 6 cut(s) 64, 82, 146, 196, 283, 387
SduI GDGCHC 3 cut(s) 252, 418, 569
SetI ASST 9 cut(s) 170, 241, 310, 400, 433, 462, 611, 630, 649
SfaNI GCATC 3 cut(s) 40, 111, 566
SfcI CTRYAG 1 cut(s) 321
SmiMI CAYNNNNRTG 1 cut(s) 562
SmlI CTYRAG 3 cut(s) 263, 393, 399
SmoI CTYRAG 3 cut(s) 263, 393, 399
Sse9I AATT 5 cut(s) 4, 44, 112, 209, 682
SsiI CCGC 4 cut(s) 223, 444, 478, 652
SspMI CTAG 1 cut(s) 174
TaaI ACNGT 3 cut(s) 385, 490, 596
TaiI ACGT 1 cut(s) 433
TaqI TCGA 2 cut(s) 85, 286
TasI AATT 5 cut(s) 4, 44, 112, 209, 682
TatI WGTACW 1 cut(s) 365
TauI GCSGC 1 cut(s) 480
TfiI GAWTC 3 cut(s) 71, 187, 317
Tru1I TTAA 3 cut(s) 92, 450, 685
Tru9I TTAA 3 cut(s) 92, 450, 685
TscAI CASTG 1 cut(s) 567
TseFI GTSAC 1 cut(s) 494
TseI GCWGC 2 cut(s) 53, 474
Tsp45I GTSAC 1 cut(s) 494
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 1 cut(s) 567
VneI GTGCAC 2 cut(s) 414, 565
XapI RAATTY 4 cut(s) 4, 44, 112, 209
XceI RCATGY 1 cut(s) 350
XspI CTAG 1 cut(s) 174
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.