Rmu_sc0003958.1_g000018

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0003958.1
OG0014038
Physical Location & Seq
Reverse (-)
96781 .. 104055
7275 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 1929 bp
atgggtgcagaccgtgcagctagtgatcactctacacatgatgtatttgttggacaacttgcctctctagtatccaccacaattgagcatgttatagctccagatgttagatttgaaactgttgatctgacaacaaggctgcttttaccaataattgtgctgcaaaatcataatcggtacaatattatagagaagggccacaactacagtataaatattgaagcaattgaggcacaggtgaagaaaatggttcatgatgggcaagaagttgtgatcgttgggggttcacattcattacatcgccatgagaagttggcaattgccgtttcaaaagctatgcgaggccattcccttcaagaaactaggaatgatggacgctttcatgttcataccaagacatatctggatggtgctcttcttaaagaagagatggaacgttctgctgatgtgcttgctgctggtttgcttgaggtggctgacccatctctttcgagtaaatttttcctccgccagcattggaatgatgaatctgttggtgcaagtgattctatactcaaacataaacctctttggtctacttatgacaaaaaaggtggcaagaagaaaaagaaaaaagaaaggaaacagggagatctgtaccgaacttatggaacaagagtaattcctgtttatgtgtcagaaacacagagaaggcatgccgaaccatctcaggtacagcgtcatatattggcagggcttgcttctgctgtggcagggttgagtgcaccatatgagaaggcttctcatgtacatgaaaggccagtcgtgaattggctatgggcagctgggtgtcatccatttggaccattctctaatacttctaaagtcagccaaatgcttcaagatgttgcattgaggaactcaatatatgcgcgtgtagattctgcactccacaaaatccgtgatacgtcagaggctgtacaaacatttgctgccgagtatctgaaaactccgcttggtgagccagtgaagggcaagaagaacaaaaccaccactgagctatgggtggagaagttttacaagaagaccactaacttgcctgaacctttcccacatgaattagttgatagattggagaacttcttaaataaccttgaggagcagctagtagatttgtcttcatcattgtatggtcaccggctccaagatgcacatttcaacagttctgagattctccagagttccatatttacccagcagtatgtagatcatgttttgtcaaacgagagggaaaagatgaaatgctgcaacattgagtacaaatatcctgtgcagtcatctcaaacttatgtctatggggggattcttcttgctggattcgttggagaggaccgcgaagtggctactccttggttcaagtttctgtgggaatcccacagaacagtgctggacatcttatggaacaactcaaagttcgatgctcttcatgcgttgagaagagctttaaaagaacttaagccagacagatttgcagttgattgcatcatctgttgcttggctacactttcagttgccctttataatgctacctctcatttggaacttaaaaaagggaaagaaagcaactcgaggatggttaatctacttgagtttagtattgatcccaaactagacagaggacatgtgctttcaagatcatctcttctatcagaactggtctcgactggtgttttgagctatgcaagccaggaagtgcaagatctctaccaacacctggagcatgagcatgagcatgaacatgaactgctacctacagatcttttgaccaaaatttcaaaaattaggggtaagctgtcttcaccttcttctgttccagaactacaactgtctcgacatgctcccgctcttgaaaagcttggtactttgaggttgctccaggaggtgtgttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

642

Amino Acids

72.6

Weight (kDa)

7.47

Isoelectric Point (pI)

45.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
eIF3a_PCI_TPR-like PF22591 456 - 488 1.7e-08 eIF3a, PCI domain, TPR-like region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014038)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G16180
fragaria_vesca FvH4_4g19930 FvH4_4g19930
malus_domestica MD16G1152500.v1.1
prunus_persica Prupe.1G115700_v2.0.a1 Prupe.1G115700_v2.0.a1
pyrus_communis pycom16g12970
rosa_chinensis RchiOBHm_Chr4g0425571
rosa_laevigata RLG00000007353
rosa_multiflora Rmu_sc0001900.1_g000001 Rmu_sc0003958.1_g000018
rosa_roxburghii Rroxscaffold_5G00367540
rosa_rugosa Rorug04G0204200
rosa_samantha Rh4AG261100 Rh4BG267000 Rh4CG278200
rosa_wichuraiana Rw4G022610

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 1560
AccB7I CCANNNNNTGG 1 cut(s) 1753
AccBSI CCGCTC 1 cut(s) 1883
AccI GTMKAC 1 cut(s) 575
AccII CGCG 2 cut(s) 913, 1374
AciI CCGC 4 cut(s) 508, 992, 1372, 1881
AclI AACGTT 1 cut(s) 436
AclWI GGATC 1 cut(s) 1634
AcsI RAATTY 2 cut(s) 497, 1809
AfaI GTAC 7 cut(s) 179, 638, 714, 789, 960, 1298, 1900
AfiI CCNNNNNNNGG 3 cut(s) 1010, 1378, 1753
AflII CTTAAG 1 cut(s) 1493
AflIII ACRYGT 1 cut(s) 1660
AjnI CCWGG 3 cut(s) 1725, 1752, 1914
Alw21I GWGCWC 2 cut(s) 415, 766
Alw26I GTCTC 2 cut(s) 1702, 1872
Alw44I GTGCAC 1 cut(s) 762
AlwI GGATC 1 cut(s) 1634
AlwNI CAGNNNCTG 1 cut(s) 956
Ama87I CYCGRG 1 cut(s) 1606
AoxI GGCC 3 cut(s) 196, 343, 797
ApaLI GTGCAC 1 cut(s) 762
ApeKI GCWGC 8 cut(s) 17, 139, 160, 455, 821, 971, 1141, 1284
ApoI RAATTY 2 cut(s) 497, 1809
ArsI GACNNNNNNTTYG 2 cut(s) 1693, 1725
AspLEI GCGC 1 cut(s) 913
AspS9I GGNCC 3 cut(s) 196, 842, 1369
AsuHPI GGTGA 4 cut(s) 250, 1010, 1166, 1830
AvaI CYCGRG 1 cut(s) 1606
AvaII GGWCC 2 cut(s) 842, 1369
BaeGI GKGCMC 1 cut(s) 766
BarI GAAGNNNNNNTAC 2 cut(s) 1819, 1851
BbsI GAAGAC 3 cut(s) 1070, 1149, 1827
Bbv12I GWGCWC 2 cut(s) 415, 766
BbvI GCAGC 8 cut(s) 29, 126, 147, 442, 833, 958, 1153, 1271
BccI CCATC 7 cut(s) 251, 365, 401, 424, 490, 712, 1606
BceAI ACGGC 1 cut(s) 308
BciT130I CCWGG 3 cut(s) 1727, 1754, 1916
BciVI GTATCC 1 cut(s) 82
BclI TGATCA 1 cut(s) 25
BcoDI GTCTC 2 cut(s) 1702, 1872
BfaI CTAG 5 cut(s) 21, 68, 363, 1145, 1649
BfmI CTRYAG 2 cut(s) 205, 1791
BfrI CTTAAG 1 cut(s) 1493
BfuI GTATCC 1 cut(s) 82
BglII AGATCT 3 cut(s) 631, 1738, 1795
BisI GCNGC 8 cut(s) 18, 140, 161, 456, 822, 972, 1142, 1285
BlsI GCNGC 8 cut(s) 19, 141, 162, 457, 823, 973, 1143, 1286
Bme1390I CCNGG 3 cut(s) 1727, 1754, 1916
Bme18I GGWCC 2 cut(s) 842, 1369
BmeT110I CYCGRG 1 cut(s) 1606
BmgT120I GGNCC 3 cut(s) 196, 842, 1369
BmiI GGNNCC 1 cut(s) 1181
BmrFI CCNGG 3 cut(s) 1727, 1754, 1916
BmsI GCATC 3 cut(s) 1177, 1447, 1530
BpiI GAAGAC 3 cut(s) 1070, 1149, 1827
BpmI CTGGAG 4 cut(s) 84, 1199, 1775, 1898
BpuEI CTTGAG 3 cut(s) 488, 1154, 1646
BsaI GGTCTC 1 cut(s) 1702
BsaJI CCNNGG 1 cut(s) 1388
Bsc4I CCNNNNNNNGG 3 cut(s) 1010, 1378, 1753
Bse118I RCCGGY 1 cut(s) 1176
Bse1I ACTGG 4 cut(s) 800, 1004, 1698, 1708
BseBI CCWGG 3 cut(s) 1727, 1754, 1916
BseDI CCNNGG 1 cut(s) 1388
BseGI GGATG 3 cut(s) 412, 832, 1617
BseLI CCNNNNNNNGG 3 cut(s) 1010, 1378, 1753
BseMII CTCAG 3 cut(s) 722, 1026, 1197
BseNI ACTGG 4 cut(s) 800, 1004, 1698, 1708
BseRI GAGGAG 1 cut(s) 1151
BseSI GKGCMC 1 cut(s) 766
BseXI GCAGC 8 cut(s) 29, 126, 147, 442, 833, 958, 1153, 1271
BseYI CCCAGC 2 cut(s) 824, 1233
BsgI GTGCAG 4 cut(s) 27, 36, 909, 1331
Bsh1236I CGCG 2 cut(s) 913, 1374
BshFI GGCC 3 cut(s) 198, 345, 799
BsiHKAI GWGCWC 2 cut(s) 415, 766
BsiHKCI CYCGRG 1 cut(s) 1606
BsiSI CCGG 1 cut(s) 1177
BslI CCNNNNNNNGG 3 cut(s) 1010, 1378, 1753
BsmAI GTCTC 2 cut(s) 1702, 1872
BsnI GGCC 3 cut(s) 198, 345, 799
Bso31I GGTCTC 1 cut(s) 1702
BsoBI CYCGRG 1 cut(s) 1606
Bsp1286I GDGCHC 2 cut(s) 415, 766
Bsp1407I TGTACA 2 cut(s) 787, 958
Bsp143I GATC 9 cut(s) 25, 124, 273, 631, 1246, 1639, 1673, 1738, 1795
BspACI CCGC 4 cut(s) 508, 992, 1372, 1881
BspANI GGCC 3 cut(s) 198, 345, 799
BspCNI CTCAG 3 cut(s) 721, 1027, 1198
BspFNI CGCG 2 cut(s) 913, 1374
BspHI TCATGA 1 cut(s) 253
BspLI GGNNCC 1 cut(s) 1181
BspPI GGATC 1 cut(s) 1634
BspQI GCTCTTC 3 cut(s) 420, 1467, 1471
BspTI CTTAAG 1 cut(s) 1493
BspTNI GGTCTC 1 cut(s) 1702
BsrBI CCGCTC 1 cut(s) 1883
BsrFI RCCGGY 1 cut(s) 1176
BsrGI TGTACA 2 cut(s) 787, 958
BsrI ACTGG 4 cut(s) 800, 1004, 1698, 1708
BssAI RCCGGY 1 cut(s) 1176
BssECI CCNNGG 1 cut(s) 1388
BssMI GATC 9 cut(s) 25, 124, 273, 631, 1246, 1639, 1673, 1738, 1795
BssT1I CCWWGG 1 cut(s) 1388
Bst2UI CCWGG 3 cut(s) 1727, 1754, 1916
Bst4CI ACNGT 6 cut(s) 14, 121, 209, 1202, 1423, 1866
Bst6I CTCTTC 5 cut(s) 420, 420, 1467, 1471, 1686
BstAFI CTTAAG 1 cut(s) 1493
BstAPI GCANNNNNTGC 2 cut(s) 14, 737
BstAUI TGTACA 2 cut(s) 787, 958
BstC8I GCNNGC 5 cut(s) 453, 512, 696, 738, 1723
BstDEI CTNAG 3 cut(s) 708, 1035, 1206
BstEII GGTNACC 1 cut(s) 1172
BstF5I GGATG 3 cut(s) 412, 832, 1617
BstFNI CGCG 2 cut(s) 913, 1374
BstHHI GCGC 1 cut(s) 913
BstKTI GATC 9 cut(s) 28, 127, 276, 634, 1249, 1642, 1676, 1741, 1798
BstMAI GTCTC 2 cut(s) 1702, 1872
BstMBI GATC 9 cut(s) 25, 124, 273, 631, 1246, 1639, 1673, 1738, 1795
BstMWI GCNNNNNNNGC 6 cut(s) 14, 230, 737, 1000, 1466, 1722
BstNI CCWGG 3 cut(s) 1727, 1754, 1916
BstNSI RCATGY 4 cut(s) 92, 698, 1664, 1877
BstPI GGTNACC 1 cut(s) 1172
BstSCI CCNGG 3 cut(s) 1725, 1752, 1914
BstSFI CTRYAG 2 cut(s) 205, 1791
BstSLI GKGCMC 1 cut(s) 766
BstUI CGCG 2 cut(s) 913, 1374
BstV1I GCAGC 8 cut(s) 29, 126, 147, 442, 833, 958, 1153, 1271
BstV2I GAAGAC 3 cut(s) 1070, 1149, 1827
BstX2I RGATCY 3 cut(s) 631, 1738, 1795
BstYI RGATCY 3 cut(s) 631, 1738, 1795
BsuI GTATCC 1 cut(s) 82
BsuRI GGCC 3 cut(s) 198, 345, 799
BtgZI GCGATG 1 cut(s) 284
BtsCI GGATG 3 cut(s) 412, 832, 1617
BtsIMutI CAGTG 3 cut(s) 1011, 1032, 1428
Cac8I GCNNGC 5 cut(s) 453, 512, 696, 738, 1723
CaiI CAGNNNCTG 1 cut(s) 956
CciI TCATGA 1 cut(s) 253
CfoI GCGC 1 cut(s) 913
Cfr10I RCCGGY 1 cut(s) 1176
Cfr13I GGNCC 3 cut(s) 196, 842, 1369
CseI GACGC 2 cut(s) 384, 707
Csp6I GTAC 7 cut(s) 178, 637, 713, 788, 959, 1297, 1899
CspCI CAANNNNNGTGG 4 cut(s) 64, 99, 574, 609
CviQI GTAC 7 cut(s) 178, 637, 713, 788, 959, 1297, 1899
DdeI CTNAG 3 cut(s) 708, 1035, 1206
DpnI GATC 9 cut(s) 27, 126, 275, 633, 1248, 1641, 1675, 1740, 1797
DpnII GATC 9 cut(s) 25, 124, 273, 631, 1246, 1639, 1673, 1738, 1795
DraI TTTAAA 1 cut(s) 1485
Eam1104I CTCTTC 5 cut(s) 420, 420, 1467, 1471, 1686
EarI CTCTTC 5 cut(s) 420, 420, 1467, 1471, 1686
EciI GGCGGA 1 cut(s) 497
Eco130I CCWWGG 1 cut(s) 1388
Eco31I GGTCTC 1 cut(s) 1702
Eco47I GGWCC 2 cut(s) 842, 1369
Eco88I CYCGRG 1 cut(s) 1606
Eco91I GGTNACC 1 cut(s) 1172
EcoO65I GGTNACC 1 cut(s) 1172
EcoRII CCWGG 3 cut(s) 1725, 1752, 1914
EcoT14I CCWWGG 1 cut(s) 1388
ErhI CCWWGG 1 cut(s) 1388
FauI CCCGC 1 cut(s) 1888
FauNDI CATATG 1 cut(s) 769
FbaI TGATCA 1 cut(s) 25
FblI GTMKAC 1 cut(s) 575
Fnu4HI GCNGC 8 cut(s) 18, 140, 161, 456, 822, 972, 1142, 1285
FokI GGATG 3 cut(s) 419, 819, 1624
Fsp4HI GCNGC 8 cut(s) 18, 140, 161, 456, 822, 972, 1142, 1285
FspBI CTAG 5 cut(s) 21, 68, 363, 1145, 1649
GlaI GCGC 1 cut(s) 912
GluI GCNGC 8 cut(s) 18, 140, 161, 456, 822, 972, 1142, 1285
GsaI CCCAGC 2 cut(s) 828, 1237
GsuI CTGGAG 4 cut(s) 84, 1199, 1775, 1898
HaeIII GGCC 3 cut(s) 198, 345, 799
HapII CCGG 1 cut(s) 1177
HgaI GACGC 2 cut(s) 384, 707
HhaI GCGC 1 cut(s) 913
Hin6I GCGC 1 cut(s) 911
HinP1I GCGC 1 cut(s) 911
HindIII AAGCTT 1 cut(s) 1892
HinfI GANTC 7 cut(s) 527, 545, 920, 1210, 1342, 1356, 1409
HpaII CCGG 1 cut(s) 1177
HphI GGTGA 4 cut(s) 250, 1010, 1166, 1830
Hpy166II GTNNAC 3 cut(s) 287, 576, 764
Hpy188I TCNGA 6 cut(s) 129, 679, 952, 984, 1207, 1690
Hpy8I GTNNAC 3 cut(s) 287, 576, 764
HpyAV CCTTC 6 cut(s) 187, 362, 684, 769, 1003, 1851
HpyCH4III ACNGT 6 cut(s) 14, 121, 209, 1202, 1423, 1866
HpyCH4IV ACGT 2 cut(s) 436, 947
HpyF10VI GCNNNNNNNGC 6 cut(s) 14, 230, 737, 1000, 1466, 1722
HpyF3I CTNAG 3 cut(s) 708, 1035, 1206
HpySE526I ACGT 2 cut(s) 436, 947
HspAI GCGC 1 cut(s) 911
Ksp22I TGATCA 1 cut(s) 25
Kzo9I GATC 9 cut(s) 25, 124, 273, 631, 1246, 1639, 1673, 1738, 1795
LguI GCTCTTC 3 cut(s) 420, 1467, 1471
LmnI GCTCC 6 cut(s) 103, 1138, 1185, 1756, 1882, 1917
Lsp1109I GCAGC 8 cut(s) 29, 126, 147, 442, 833, 958, 1153, 1271
LweI GCATC 3 cut(s) 1177, 1447, 1530
MaeI CTAG 5 cut(s) 21, 68, 363, 1145, 1649
MaeII ACGT 2 cut(s) 436, 947
MaeIII GTNAC 1 cut(s) 1172
MalI GATC 9 cut(s) 27, 126, 275, 633, 1248, 1641, 1675, 1740, 1797
MbiI CCGCTC 1 cut(s) 1883
MboI GATC 9 cut(s) 25, 124, 273, 631, 1246, 1639, 1673, 1738, 1795
MfeI CAATTG 3 cut(s) 81, 225, 318
MflI RGATCY 3 cut(s) 631, 1738, 1795
MhlI GDGCHC 2 cut(s) 415, 766
MmeI TCCRAC 2 cut(s) 31, 1342
MseI TTAA 6 cut(s) 420, 1124, 1484, 1494, 1584, 1617
MslI CAYNNNNRTG 6 cut(s) 303, 519, 789, 1764, 1770, 1776
MspA1I CMGCKG 1 cut(s) 824
MspCI CTTAAG 1 cut(s) 1493
MspI CCGG 1 cut(s) 1177
MspR9I CCNGG 3 cut(s) 1727, 1754, 1916
MunI CAATTG 3 cut(s) 81, 225, 318
MvaI CCWGG 3 cut(s) 1727, 1754, 1916
MvnI CGCG 2 cut(s) 913, 1374
MwoI GCNNNNNNNGC 6 cut(s) 14, 230, 737, 1000, 1466, 1722
NdeI CATATG 1 cut(s) 769
NdeII GATC 9 cut(s) 25, 124, 273, 631, 1246, 1639, 1673, 1738, 1795
NlaIV GGNNCC 1 cut(s) 1181
NmeAIII GCCGAG 1 cut(s) 1000
NmuCI GTSAC 1 cut(s) 1172
NspI RCATGY 4 cut(s) 92, 698, 1664, 1877
PaeI GCATGC 1 cut(s) 698
PaeR7I CTCGAG 1 cut(s) 1606
PagI TCATGA 1 cut(s) 253
PciI ACATGT 1 cut(s) 1660
PciSI GCTCTTC 3 cut(s) 420, 1467, 1471
PfeI GAWTC 7 cut(s) 527, 545, 920, 1210, 1342, 1356, 1409
PflMI CCANNNNNTGG 1 cut(s) 1753
PfoI TCCNGGA 1 cut(s) 1914
PkrI GCNGC 8 cut(s) 19, 141, 162, 457, 823, 973, 1143, 1286
PscI ACATGT 1 cut(s) 1660
PsiI TTATAA 1 cut(s) 1560
Psp1406I AACGTT 1 cut(s) 436
Psp6I CCWGG 3 cut(s) 1725, 1752, 1914
PspEI GGTNACC 1 cut(s) 1172
PspFI CCCAGC 2 cut(s) 824, 1233
PspGI CCWGG 3 cut(s) 1725, 1752, 1914
PspN4I GGNNCC 1 cut(s) 1181
PspPI GGNCC 3 cut(s) 196, 842, 1369
PspXI VCTCGAGB 1 cut(s) 1606
PstNI CAGNNNCTG 1 cut(s) 956
PsuI RGATCY 3 cut(s) 631, 1738, 1795
PvuII CAGCTG 1 cut(s) 824
RsaI GTAC 7 cut(s) 179, 638, 714, 789, 960, 1298, 1900
RsaNI GTAC 7 cut(s) 178, 637, 713, 788, 959, 1297, 1899
RseI CAYNNNNRTG 6 cut(s) 303, 519, 789, 1764, 1770, 1776
SapI GCTCTTC 3 cut(s) 420, 1467, 1471
SaqAI TTAA 6 cut(s) 420, 1124, 1484, 1494, 1584, 1617
SatI GCNGC 8 cut(s) 18, 140, 161, 456, 822, 972, 1142, 1285
Sau3AI GATC 9 cut(s) 25, 124, 273, 631, 1246, 1639, 1673, 1738, 1795
Sau96I GGNCC 3 cut(s) 196, 842, 1369
ScrFI CCNGG 3 cut(s) 1727, 1754, 1916
SduI GDGCHC 2 cut(s) 415, 766
SfaNI GCATC 3 cut(s) 1177, 1447, 1530
SfcI CTRYAG 2 cut(s) 205, 1791
Sfr274I CTCGAG 1 cut(s) 1606
SinI GGWCC 2 cut(s) 842, 1369
SlaI CTCGAG 1 cut(s) 1606
SmiMI CAYNNNNRTG 6 cut(s) 303, 519, 789, 1764, 1770, 1776
SmlI CTYRAG 5 cut(s) 467, 1133, 1493, 1606, 1625
SmoI CTYRAG 5 cut(s) 467, 1133, 1493, 1606, 1625
SphI GCATGC 1 cut(s) 698
SsiI CCGC 4 cut(s) 508, 992, 1372, 1881
SspI AATATT 2 cut(s) 184, 217
SspMI CTAG 5 cut(s) 21, 68, 363, 1145, 1649
StyD4I CCNGG 3 cut(s) 1725, 1752, 1914
StyI CCWWGG 1 cut(s) 1388
TaaI ACNGT 6 cut(s) 14, 121, 209, 1202, 1423, 1866
TaiI ACGT 2 cut(s) 439, 950
TaqI TCGA 5 cut(s) 491, 1455, 1607, 1700, 1870
TatI WGTACW 3 cut(s) 787, 958, 1296
TfiI GAWTC 7 cut(s) 527, 545, 920, 1210, 1342, 1356, 1409
Tru1I TTAA 6 cut(s) 420, 1124, 1484, 1494, 1584, 1617
Tru9I TTAA 6 cut(s) 420, 1124, 1484, 1494, 1584, 1617
TscAI CASTG 3 cut(s) 1011, 1039, 1428
TseFI GTSAC 1 cut(s) 1172
TseI GCWGC 8 cut(s) 17, 139, 160, 455, 821, 971, 1141, 1284
Tsp45I GTSAC 1 cut(s) 1172
TspGWI ACGGA 1 cut(s) 929
TspRI CASTG 3 cut(s) 1011, 1039, 1428
Van91I CCANNNNNTGG 1 cut(s) 1753
Vha464I CTTAAG 1 cut(s) 1493
VneI GTGCAC 1 cut(s) 762
VpaK11BI GGWCC 2 cut(s) 842, 1369
XapI RAATTY 2 cut(s) 497, 1809
XceI RCATGY 4 cut(s) 92, 698, 1664, 1877
XcmI CCANNNNNNNNNTGG 2 cut(s) 400, 807
XhoI CTCGAG 1 cut(s) 1606
XmiI GTMKAC 1 cut(s) 575
XspI CTAG 5 cut(s) 21, 68, 363, 1145, 1649
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.