Rorug04G0204200

RNA-binding component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis of a specialized repertoire of mRNAs and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome. The eIF-3 complex specifically targets and initiates translation of a subset of mRNAs involved in cell proliferation

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000004
Physical Location & Seq
Reverse (-)
35493362 .. 35496758
3397 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug04G0204200.1

Sequence Viewer

Length: 411 bp
ATGTCGTCCTCAGCCCTCAAGTCCAAGAAGAGAAAGACACGTTATATATCTTCCTCTCAACGTCAGTTCGATCTCTCTCTCTTTTCTTGTTTGTTAATAGTATCTGAATTGTGTGTGGGTCAGAGGTCGGTGAAGAAGAAAGGGCTGTATTCTTTACCCCCGGTCGTGGCAGGCTTCTTTATCACTTGTGATCGTGCTGCTGCTTTATATGCAAAAGTATCCAATTTCTCTCTTAATGTCTATGGTCTGAATACCAAATCAAAGTATTGCTTGACCAACAAGAGAGGTTGTATGAAAGACAAGCTGAACTACAAGCTCTACTGGAAGCTTCCAAAGGTCCTGGACCCCCTGTTAATGGGGCTTCAACAGCCACAGAAGGCTGGTCTGGATCATCGCGAGTGCTTGACCTAG

Protein Analysis

136

Amino Acids

15.38

Weight (kDa)

9.9

Isoelectric Point (pI)

47.41

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 396
AclWI GGATC 1 cut(s) 396
AfiI CCNNNNNNNGG 2 cut(s) 166, 355
AflIII ACRYGT 1 cut(s) 38
AgsI TTSAA 1 cut(s) 365
AjnI CCWGG 1 cut(s) 339
AluBI AGCT 3 cut(s) 304, 316, 328
AluI AGCT 3 cut(s) 304, 316, 328
AlwI GGATC 1 cut(s) 396
ApeKI GCWGC 2 cut(s) 197, 200
AspS9I GGNCC 2 cut(s) 337, 343
AsuC2I CCSGG 1 cut(s) 161
AsuHPI GGTGA 1 cut(s) 142
AvaII GGWCC 2 cut(s) 337, 343
BbvCI CCTCAGC 1 cut(s) 10
BbvI GCAGC 2 cut(s) 184, 187
BciT130I CCWGG 1 cut(s) 341
BciVI GTATCC 1 cut(s) 229
BcnI CCSGG 1 cut(s) 161
BfaI CTAG 1 cut(s) 409
BfuI GTATCC 1 cut(s) 229
BisI GCNGC 2 cut(s) 198, 201
BlsI GCNGC 2 cut(s) 199, 202
Bme1390I CCNGG 2 cut(s) 161, 341
Bme18I GGWCC 2 cut(s) 337, 343
BmgT120I GGNCC 2 cut(s) 337, 343
BmiI GGNNCC 1 cut(s) 345
BmrFI CCNGG 2 cut(s) 161, 341
Bpu10I CCTNAGC 1 cut(s) 10
BpuMI CCSGG 1 cut(s) 161
BsaJI CCNNGG 1 cut(s) 159
Bsc4I CCNNNNNNNGG 2 cut(s) 166, 355
Bse1I ACTGG 1 cut(s) 326
BseBI CCWGG 1 cut(s) 341
BseDI CCNNGG 1 cut(s) 159
BseLI CCNNNNNNNGG 2 cut(s) 166, 355
BseMII CTCAG 1 cut(s) 24
BseNI ACTGG 1 cut(s) 326
BseXI GCAGC 2 cut(s) 184, 187
Bsh1236I CGCG 1 cut(s) 396
Bsh1285I CGRYCG 1 cut(s) 165
BsiEI CGRYCG 1 cut(s) 165
BsiSI CCGG 1 cut(s) 161
BslI CCNNNNNNNGG 2 cut(s) 166, 355
Bsp143I GATC 3 cut(s) 70, 190, 388
Bsp68I TCGCGA 1 cut(s) 396
BspCNI CTCAG 1 cut(s) 23
BspFNI CGCG 1 cut(s) 396
BspLI GGNNCC 1 cut(s) 345
BspPI GGATC 1 cut(s) 396
BsrI ACTGG 1 cut(s) 326
BssECI CCNNGG 1 cut(s) 159
BssMI GATC 3 cut(s) 70, 190, 388
Bst2UI CCWGG 1 cut(s) 341
Bst6I CTCTTC 1 cut(s) 23
BstC8I GCNNGC 1 cut(s) 172
BstDEI CTNAG 1 cut(s) 10
BstFNI CGCG 1 cut(s) 396
BstKTI GATC 3 cut(s) 73, 193, 391
BstMBI GATC 3 cut(s) 70, 190, 388
BstMCI CGRYCG 1 cut(s) 165
BstMWI GCNNNNNNNGC 2 cut(s) 209, 367
BstNI CCWGG 1 cut(s) 341
BstSCI CCNGG 2 cut(s) 159, 339
BstUI CGCG 1 cut(s) 396
BstV1I GCAGC 2 cut(s) 184, 187
BsuI GTATCC 1 cut(s) 229
BtgZI GCGATG 1 cut(s) 377
BtuMI TCGCGA 1 cut(s) 396
Cac8I GCNNGC 1 cut(s) 172
Cfr13I GGNCC 2 cut(s) 337, 343
CviJI RGCY 9 cut(s) 14, 145, 174, 304, 316, 328, 361, 370, 380
CviKI_1 RGCY 9 cut(s) 14, 145, 174, 304, 316, 328, 361, 370, 380
DdeI CTNAG 1 cut(s) 10
DpnI GATC 3 cut(s) 72, 192, 390
DpnII GATC 3 cut(s) 70, 190, 388
Eam1104I CTCTTC 1 cut(s) 23
EarI CTCTTC 1 cut(s) 23
Eco47I GGWCC 2 cut(s) 337, 343
EcoO109I RGGNCCY 1 cut(s) 337
EcoRII CCWGG 1 cut(s) 339
FaiI YATR 6 cut(s) 45, 47, 208, 210, 243, 293
FalI AAGNNNNNCTT 2 cut(s) 254, 286
Fnu4HI GCNGC 2 cut(s) 198, 201
Fsp4HI GCNGC 2 cut(s) 198, 201
FspBI CTAG 1 cut(s) 409
GluI GCNGC 2 cut(s) 198, 201
HapII CCGG 1 cut(s) 161
HindIII AAGCTT 1 cut(s) 326
HpaII CCGG 1 cut(s) 161
HphI GGTGA 1 cut(s) 142
Hpy188I TCNGA 3 cut(s) 106, 123, 249
Hpy188III TCNNGA 2 cut(s) 386, 395
HpyAV CCTTC 1 cut(s) 370
HpyCH4IV ACGT 2 cut(s) 40, 61
HpyCH4V TGCA 1 cut(s) 212
HpyF10VI GCNNNNNNNGC 2 cut(s) 209, 367
HpyF3I CTNAG 1 cut(s) 10
HpySE526I ACGT 2 cut(s) 40, 61
Kzo9I GATC 3 cut(s) 70, 190, 388
LpnPI CCDG 8 cut(s) 156, 174, 307, 326, 353, 362, 366, 371
Lsp1109I GCAGC 2 cut(s) 184, 187
MaeI CTAG 1 cut(s) 409
MaeII ACGT 2 cut(s) 40, 61
MalI GATC 3 cut(s) 72, 192, 390
MboI GATC 3 cut(s) 70, 190, 388
MboII GAAGA 4 cut(s) 40, 42, 145, 148
MluCI AATT 2 cut(s) 107, 223
MnlI CCTC 5 cut(s) 19, 26, 64, 117, 278
MseI TTAA 3 cut(s) 95, 234, 353
MspI CCGG 1 cut(s) 161
MspR9I CCNGG 2 cut(s) 161, 341
MvaI CCWGG 1 cut(s) 341
MvnI CGCG 1 cut(s) 396
MwoI GCNNNNNNNGC 2 cut(s) 209, 367
NciI CCSGG 1 cut(s) 161
NdeII GATC 3 cut(s) 70, 190, 388
NlaIV GGNNCC 1 cut(s) 345
NruI TCGCGA 1 cut(s) 396
PfoI TCCNGGA 1 cut(s) 339
PkrI GCNGC 2 cut(s) 199, 202
PpuMI RGGWCCY 1 cut(s) 337
Psp5II RGGWCCY 1 cut(s) 337
Psp6I CCWGG 1 cut(s) 339
PspGI CCWGG 1 cut(s) 339
PspN4I GGNNCC 1 cut(s) 345
PspPI GGNCC 2 cut(s) 337, 343
PspPPI RGGWCCY 1 cut(s) 337
RruI TCGCGA 1 cut(s) 396
SaqAI TTAA 3 cut(s) 95, 234, 353
SatI GCNGC 2 cut(s) 198, 201
Sau3AI GATC 3 cut(s) 70, 190, 388
Sau96I GGNCC 2 cut(s) 337, 343
ScrFI CCNGG 2 cut(s) 161, 341
SetI ASST 9 cut(s) 43, 64, 128, 289, 306, 318, 330, 339, 410
SinI GGWCC 2 cut(s) 337, 343
SmlI CTYRAG 1 cut(s) 17
SmoI CTYRAG 1 cut(s) 17
Sse9I AATT 2 cut(s) 107, 223
SspMI CTAG 1 cut(s) 409
StyD4I CCNGG 2 cut(s) 159, 339
TaiI ACGT 2 cut(s) 43, 64
TaqI TCGA 1 cut(s) 69
TasI AATT 2 cut(s) 107, 223
Tru1I TTAA 3 cut(s) 95, 234, 353
Tru9I TTAA 3 cut(s) 95, 234, 353
TseI GCWGC 2 cut(s) 197, 200
TspDTI ATGAA 1 cut(s) 308
VpaK11BI GGWCC 2 cut(s) 337, 343
XspI CTAG 1 cut(s) 409
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.