RchiOBHm_Chr4g0425631

Flotillin-like protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
51211027 .. 51211287
261 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39476

Sequence Viewer

Length: 261 bp
ATGGAGGCTGCCAACCAGGCCAAGGTTGACATGGCCGAGGCCAAAATGAAGGGAGAGGTTGGCTCTAAGCTGAGGGAGGGGCAGACATTGCAAAACGGAGGCAAGATCGACTCCCAGACGAAGATCATTTTGACTCAGAGGCAAGGGGAGGGAAAGAAGGAGGAGATTAAGGTGAAAACGGAGGTCAAGGTTTATAAGAATCAGAGAGAAGCTGAGGTGGCTAAAGCGAATGCTGAGTTGGCAATGAAGAAGGCAGGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

86

Amino Acids

9.42

Weight (kDa)

9.52

Isoelectric Point (pI)

19.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 195
AcoI YGGCCR 1 cut(s) 33
AfiI CCNNNNNNNGG 1 cut(s) 22
AjnI CCWGG 1 cut(s) 15
AjuI GAANNNNNNNTTGG 2 cut(s) 221, 253
AluBI AGCT 2 cut(s) 70, 212
AluI AGCT 2 cut(s) 70, 212
AoxI GGCC 3 cut(s) 18, 33, 39
ApeKI GCWGC 1 cut(s) 8
AsuHPI GGTGA 1 cut(s) 184
BbvCI CCTCAGC 2 cut(s) 71, 213
BciT130I CCWGG 1 cut(s) 17
BglI GCCNNNNNGGC 1 cut(s) 17
BisI GCNGC 1 cut(s) 9
BlsI GCNGC 1 cut(s) 10
Bme1390I CCNGG 1 cut(s) 17
BmrFI CCNGG 1 cut(s) 17
BplI GAGNNNNNCTC 2 cut(s) 47, 79
Bpu10I CCTNAGC 2 cut(s) 71, 213
BsaJI CCNNGG 2 cut(s) 21, 36
Bsc4I CCNNNNNNNGG 1 cut(s) 22
Bse3DI GCAATG 2 cut(s) 86, 249
BseBI CCWGG 1 cut(s) 17
BseDI CCNNGG 2 cut(s) 21, 36
BseLI CCNNNNNNNGG 1 cut(s) 22
BseMI GCAATG 2 cut(s) 86, 249
BseMII CTCAG 4 cut(s) 62, 149, 204, 225
BseRI GAGGAG 1 cut(s) 176
BshFI GGCC 3 cut(s) 20, 35, 41
BslI CCNNNNNNNGG 1 cut(s) 22
BsmI GAATGC 1 cut(s) 235
BsnI GGCC 3 cut(s) 20, 35, 41
Bsp143I GATC 2 cut(s) 105, 123
BspANI GGCC 3 cut(s) 20, 35, 41
BspCNI CTCAG 4 cut(s) 63, 148, 205, 226
BsrDI GCAATG 2 cut(s) 86, 249
BssECI CCNNGG 2 cut(s) 21, 36
BssMI GATC 2 cut(s) 105, 123
BssT1I CCWWGG 1 cut(s) 21
Bst2UI CCWGG 1 cut(s) 17
BstAPI GCANNNNNTGC 1 cut(s) 88
BstDEI CTNAG 5 cut(s) 66, 71, 135, 213, 234
BstKTI GATC 2 cut(s) 108, 126
BstMBI GATC 2 cut(s) 105, 123
BstMWI GCNNNNNNNGC 4 cut(s) 17, 88, 218, 239
BstNI CCWGG 1 cut(s) 17
BstSCI CCNGG 1 cut(s) 15
BsuRI GGCC 3 cut(s) 20, 35, 41
CviAII CATG 1 cut(s) 31
CviJI RGCY 8 cut(s) 8, 20, 35, 41, 63, 70, 212, 221
CviKI_1 RGCY 8 cut(s) 8, 20, 35, 41, 63, 70, 212, 221
DdeI CTNAG 5 cut(s) 66, 71, 135, 213, 234
DpnI GATC 2 cut(s) 107, 125
DpnII GATC 2 cut(s) 105, 123
EaeI YGGCCR 1 cut(s) 33
Eco130I CCWWGG 1 cut(s) 21
EcoRII CCWGG 1 cut(s) 15
EcoT14I CCWWGG 1 cut(s) 21
ErhI CCWWGG 1 cut(s) 21
FaeI CATG 1 cut(s) 34
FaiI YATR 2 cut(s) 32, 195
FatI CATG 1 cut(s) 30
Fnu4HI GCNGC 1 cut(s) 9
Fsp4HI GCNGC 1 cut(s) 9
GluI GCNGC 1 cut(s) 9
HaeIII GGCC 3 cut(s) 20, 35, 41
Hin1II CATG 1 cut(s) 34
HincII GTYRAC 1 cut(s) 28
HindII GTYRAC 1 cut(s) 28
HinfI GANTC 3 cut(s) 110, 133, 199
HphI GGTGA 1 cut(s) 184
Hpy166II GTNNAC 1 cut(s) 28
Hpy188I TCNGA 2 cut(s) 138, 204
Hpy8I GTNNAC 1 cut(s) 28
HpyAV CCTTC 3 cut(s) 43, 151, 244
HpyCH4V TGCA 1 cut(s) 91
HpyF10VI GCNNNNNNNGC 4 cut(s) 17, 88, 218, 239
HpyF3I CTNAG 5 cut(s) 66, 71, 135, 213, 234
Hsp92II CATG 1 cut(s) 34
Kzo9I GATC 2 cut(s) 105, 123
LpnPI CCDG 4 cut(s) 2, 29, 128, 240
MalI GATC 2 cut(s) 107, 125
MboI GATC 2 cut(s) 105, 123
MboII GAAGA 2 cut(s) 133, 259
MlyI GAGTC 2 cut(s) 104, 127
MseI TTAA 1 cut(s) 168
MspR9I CCNGG 1 cut(s) 17
Mva1269I GAATGC 1 cut(s) 235
MvaI CCWGG 1 cut(s) 17
MwoI GCNNNNNNNGC 4 cut(s) 17, 88, 218, 239
NdeII GATC 2 cut(s) 105, 123
NlaIII CATG 1 cut(s) 34
NmeAIII GCCGAG 1 cut(s) 61
PctI GAATGC 1 cut(s) 235
PfeI GAWTC 1 cut(s) 199
PkrI GCNGC 1 cut(s) 10
PleI GAGTC 2 cut(s) 104, 127
PpsI GAGTC 2 cut(s) 104, 127
PsiI TTATAA 1 cut(s) 195
Psp6I CCWGG 1 cut(s) 15
PspGI CCWGG 1 cut(s) 15
SaqAI TTAA 1 cut(s) 168
SatI GCNGC 1 cut(s) 9
Sau3AI GATC 2 cut(s) 105, 123
SchI GAGTC 2 cut(s) 104, 127
ScrFI CCNGG 1 cut(s) 17
SetI ASST 8 cut(s) 27, 60, 72, 174, 186, 192, 214, 219
SgeI CNNG 9 cut(s) 28, 29, 34, 43, 49, 115, 127, 155, 199
StyD4I CCNGG 1 cut(s) 15
StyI CCWWGG 1 cut(s) 21
TaqI TCGA 1 cut(s) 108
TfiI GAWTC 1 cut(s) 199
Tru1I TTAA 1 cut(s) 168
Tru9I TTAA 1 cut(s) 168
TseI GCWGC 1 cut(s) 8
TspDTI ATGAA 2 cut(s) 62, 260
TspGWI ACGGA 2 cut(s) 111, 194
XcmI CCANNNNNNNNNTGG 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.