Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004339.1

Orthogroup ID

OG0012004

Physical Location & Seq

Genomic Coordinates Forward (+)

117712 .. 120008

Gene Structure 2297 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004339.1_g000031.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1014 bp

atgagaagcgcagggaaaggtagtcaggaggaggatgagtacgaagacgaagactttggctccaagaaagatgggccttcttccaattcatccaatcccaacagtaaagatgctaagagcaacgataaggctagtgctatacggtcgaagcattcggtgacggagcagcggagaaggagcaagatcaatgagagattccagatattgagagatctaataccccatagtgagcaaaagcgagatacggcatcgttcttgctagaggtgatcgaatatgtccagtatttacaggaaagggtcaacaaacatgaaggttcgtgccaggggtggagtgcagagcccacaaagttaatgccatggagaaatagccactggcgtgttcagagttttgttggtcctcctcagccgataaagaatgatactggtgtaatttcaccatttcctggaaagtttgatgaaaataacatctctattactccgaatattcttgcaaacagcacaaagaatcccgtagaatctgaacctagcagggacgttgcctctaaagtcatggatcagccacctgagatagtgaataagggacttcctccgcctatgcctctgccagaaaatctgcttccccctgtcagaaatgatggtatacttgcccgtcctctgcacggaccaatttctgatgctcaatcaactcaatgccccaccaccagtggtgatgcactgaatcaacgggaggagctgactatcgaaggtggaacaataagcatctcaagtgtttactcacaagggttattgaactctctgagtcatgcacttcagactgcaggtgtagatctgtcacaggctagtgtctcagtacagattgatcttggtaatcgcgcaaaccgagggctgtctgctggaacacctgcttctaaggatcatgagaatccacattcgagcaatcaaacgatggcacattttagggatgctggcagtggagatgattcagatcaagctcataagcggctgaagtcataa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

HLH

Protein Analysis

337

Amino Acids

36.87

Weight (kDa)

5.95

Isoelectric Point (pI)

57.77

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012004)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G69010
fragaria_vesca	FvH4_4g29230 FvH4_4g29230
malus_domestica	MD13G1056100.v1.1 MD16G1055100.v1.1
prunus_persica	Prupe.1G294200_v2.0.a1 Prupe.1G294200_v2.0.a1
pyrus_communis	pycom13g04970 pycom16g04800
rosa_chinensis	RchiOBHm_Chr4g0437281
rosa_laevigata	RLG00000006450
rosa_multiflora	Rmu_sc0004339.1_g000031
rosa_roxburghii	Rroxscaffold_5G00378420
rosa_rugosa	Rorug04G0299200
rosa_samantha	Rh4AG354000 Rh4BG363900 Rh4CG378200 Rh4DG357900
rosa_wichuraiana	Rw4G031050

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	2 cut(s)	809, 910
Acc36I	ACCTGC	2 cut(s)	809, 910
AccB7I	CCANNNNNTGG	1 cut(s)	443
AccI	GTMKAC	1 cut(s)	640
AccII	CGCG	1 cut(s)	873
AciI	CCGC	3 cut(s)	169, 590, 1000
AclWI	GGATC	2 cut(s)	561, 921
AcuI	CTGAAG	1 cut(s)	794
AfaI	GTAC	2 cut(s)	41, 852
AfiI	CCNNNNNNNGG	2 cut(s)	443, 659
AgsI	TTSAA	1 cut(s)	790
AjnI	CCWGG	2 cut(s)	321, 442
AleI	CACNNNNGTG	1 cut(s)	375
AluBI	AGCT	2 cut(s)	733, 992
AluI	AGCT	2 cut(s)	733, 992
Alw26I	GTCTC	1 cut(s)	850
AlwI	GGATC	2 cut(s)	561, 921
AoxI	GGCC	1 cut(s)	74
ApeKI	GCWGC	1 cut(s)	166
ArsI	GACNNNNNNTTYG	2 cut(s)	38, 70
AspLEI	GCGC	2 cut(s)	11, 875
AspS9I	GGNCC	3 cut(s)	74, 395, 662
AsuHPI	GGTGA	4 cut(s)	169, 277, 426, 719
AvaII	GGWCC	2 cut(s)	395, 662
BaeI	ACNNNNGTAYC	2 cut(s)	411, 444
BanII	GRGCYC	1 cut(s)	342
BbsI	GAAGAC	2 cut(s)	51, 57
BbvCI	CCTCAGC	1 cut(s)	402
BbvI	GCAGC	1 cut(s)	178
BccI	CCATC	3 cut(s)	65, 629, 940
BceAI	ACGGC	1 cut(s)	261
BciT130I	CCWGG	2 cut(s)	323, 444
BcoDI	GTCTC	1 cut(s)	850
BfaI	CTAG	4 cut(s)	132, 260, 525, 840
BfmI	CTRYAG	1 cut(s)	816
BfuAI	ACCTGC	2 cut(s)	809, 910
BglII	AGATCT	2 cut(s)	211, 826
BisI	GCNGC	2 cut(s)	167, 1001
BlsI	GCNGC	2 cut(s)	168, 1002
Bme1390I	CCNGG	2 cut(s)	323, 444
Bme18I	GGWCC	2 cut(s)	395, 662
BmgT120I	GGNCC	3 cut(s)	74, 395, 662
BmiI	GGNNCC	1 cut(s)	61
BmrFI	CCNGG	2 cut(s)	323, 444
BmsI	GCATC	6 cut(s)	100, 257, 664, 700, 768, 952
BpiI	GAAGAC	2 cut(s)	51, 57
Bpu10I	CCTNAGC	1 cut(s)	402
BpuEI	CTTGAG	1 cut(s)	748
BsaBI	GATNNNNATC	1 cut(s)	984
BsaJI	CCNNGG	3 cut(s)	322, 356, 880
BsaXI	ACNNNNNCTCC	4 cut(s)	23, 44, 53, 74
Bsc4I	CCNNNNNNNGG	2 cut(s)	443, 659
Bse1I	ACTGG	4 cut(s)	280, 377, 427, 702
Bse8I	GATNNNNATC	1 cut(s)	984
BseBI	CCWGG	2 cut(s)	323, 444
BseDI	CCNNGG	3 cut(s)	322, 356, 880
BseGI	GGATG	3 cut(s)	40, 89, 967
BseJI	GATNNNNATC	1 cut(s)	984
BseLI	CCNNNNNNNGG	2 cut(s)	443, 659
BseMII	CTCAG	4 cut(s)	416, 555, 788, 861
BseNI	ACTGG	4 cut(s)	280, 377, 427, 702
BseRI	GAGGAG	3 cut(s)	44, 390, 743
BseXI	GCAGC	1 cut(s)	178
BsgI	GTGCAG	2 cut(s)	354, 641
Bsh1236I	CGCG	1 cut(s)	873
Bsh1285I	CGRYCG	1 cut(s)	146
BshFI	GGCC	1 cut(s)	76
BsiEI	CGRYCG	1 cut(s)	146
BslFI	GGGAC	2 cut(s)	545, 594
BslI	CCNNNNNNNGG	2 cut(s)	443, 659
BsmAI	GTCTC	1 cut(s)	850
BsmFI	GGGAC	2 cut(s)	545, 594
BsmI	GAATGC	1 cut(s)	151
BsnI	GGCC	1 cut(s)	76
Bsp1286I	GDGCHC	1 cut(s)	342
Bsp143I	GATC	8 cut(s)	183, 211, 267, 553, 826, 859, 913, 985
Bsp19I	CCATGG	1 cut(s)	356
BspACI	CCGC	3 cut(s)	169, 590, 1000
BspANI	GGCC	1 cut(s)	76
BspCNI	CTCAG	4 cut(s)	415, 556, 789, 860
BspFNI	CGCG	1 cut(s)	873
BspHI	TCATGA	1 cut(s)	916
BspLI	GGNNCC	1 cut(s)	61
BspMAI	CTGCAG	1 cut(s)	820
BspMI	ACCTGC	2 cut(s)	809, 910
BspPI	GGATC	2 cut(s)	561, 921
BsrI	ACTGG	4 cut(s)	280, 377, 427, 702
BssECI	CCNNGG	3 cut(s)	322, 356, 880
BssMI	GATC	8 cut(s)	183, 211, 267, 553, 826, 859, 913, 985
BssNAI	GTATAC	1 cut(s)	641
BssT1I	CCWWGG	1 cut(s)	356
Bst1107I	GTATAC	1 cut(s)	641
Bst2UI	CCWGG	2 cut(s)	323, 444
Bst4CI	ACNGT	2 cut(s)	104, 144
BstC8I	GCNNGC	1 cut(s)	967
BstDEI	CTNAG	6 cut(s)	114, 402, 564, 797, 847, 909
BstDSI	CCRYGG	1 cut(s)	356
BstF5I	GGATG	3 cut(s)	40, 89, 967
BstFNI	CGCG	1 cut(s)	873
BstHHI	GCGC	2 cut(s)	11, 875
BstKTI	GATC	8 cut(s)	186, 214, 270, 556, 829, 862, 916, 988
BstMAI	GTCTC	1 cut(s)	850
BstMBI	GATC	8 cut(s)	183, 211, 267, 553, 826, 859, 913, 985
BstMCI	CGRYCG	1 cut(s)	146
BstNI	CCWGG	2 cut(s)	323, 444
BstSCI	CCNGG	2 cut(s)	321, 442
BstSFI	CTRYAG	1 cut(s)	816
BstUI	CGCG	1 cut(s)	873
BstV1I	GCAGC	1 cut(s)	178
BstV2I	GAAGAC	2 cut(s)	51, 57
BstX2I	RGATCY	2 cut(s)	211, 826
BstYI	RGATCY	2 cut(s)	211, 826
BstZ17I	GTATAC	1 cut(s)	641
BsuRI	GGCC	1 cut(s)	76
BtgI	CCRYGG	1 cut(s)	356
BtsCI	GGATG	3 cut(s)	40, 89, 967
BtsI	GCAGTG	1 cut(s)	976
BtsIMutI	CAGTG	4 cut(s)	370, 709, 713, 976
BveI	ACCTGC	2 cut(s)	809, 910
Cac8I	GCNNGC	1 cut(s)	967
CciI	TCATGA	1 cut(s)	916
CfoI	GCGC	2 cut(s)	11, 875
Cfr13I	GGNCC	3 cut(s)	74, 395, 662
Csp6I	GTAC	2 cut(s)	40, 851
CviAII	CATG	5 cut(s)	308, 357, 550, 803, 917
CviQI	GTAC	2 cut(s)	40, 851
DdeI	CTNAG	6 cut(s)	114, 402, 564, 797, 847, 909
DpnI	GATC	8 cut(s)	185, 213, 269, 555, 828, 861, 915, 987
DpnII	GATC	8 cut(s)	183, 211, 267, 553, 826, 859, 913, 985
EciI	GGCGGA	1 cut(s)	579
Eco130I	CCWWGG	1 cut(s)	356
Eco24I	GRGCYC	1 cut(s)	342
Eco47I	GGWCC	2 cut(s)	395, 662
Eco57I	CTGAAG	1 cut(s)	794
EcoRII	CCWGG	2 cut(s)	321, 442
EcoT14I	CCWWGG	1 cut(s)	356
EcoT38I	GRGCYC	1 cut(s)	342
ErhI	CCWWGG	1 cut(s)	356
FaeI	CATG	5 cut(s)	311, 360, 553, 806, 920
FaqI	GGGAC	2 cut(s)	545, 594
FatI	CATG	5 cut(s)	307, 356, 549, 802, 916
FblI	GTMKAC	1 cut(s)	640
Fnu4HI	GCNGC	2 cut(s)	167, 1001
FokI	GGATG	3 cut(s)	47, 76, 974
FriOI	GRGCYC	1 cut(s)	342
Fsp4HI	GCNGC	2 cut(s)	167, 1001
FspBI	CTAG	4 cut(s)	132, 260, 525, 840
GlaI	GCGC	2 cut(s)	10, 874
GluI	GCNGC	2 cut(s)	167, 1001
HaeIII	GGCC	1 cut(s)	76
HhaI	GCGC	2 cut(s)	11, 875
Hin1II	CATG	5 cut(s)	311, 360, 553, 806, 920
Hin6I	GCGC	2 cut(s)	9, 873
HinP1I	GCGC	2 cut(s)	9, 873
HincII	GTYRAC	1 cut(s)	301
HindII	GTYRAC	1 cut(s)	301
HinfI	GANTC	7 cut(s)	195, 505, 515, 718, 799, 922, 980
HphI	GGTGA	4 cut(s)	169, 277, 426, 719
Hpy166II	GTNNAC	3 cut(s)	301, 641, 772
Hpy188I	TCNGA	8 cut(s)	384, 480, 520, 629, 673, 798, 813, 985
Hpy188III	TCNNGA	3 cut(s)	26, 199, 917
Hpy8I	GTNNAC	3 cut(s)	301, 641, 772
HpyAV	CCTTC	4 cut(s)	87, 168, 305, 737
HpyCH4III	ACNGT	2 cut(s)	104, 144
HpyCH4IV	ACGT	1 cut(s)	534
HpyCH4V	TGCA	6 cut(s)	335, 491, 658, 713, 806, 818
HpyF3I	CTNAG	6 cut(s)	114, 402, 564, 797, 847, 909
HpySE526I	ACGT	1 cut(s)	534
Hsp92II	CATG	5 cut(s)	311, 360, 553, 806, 920
HspAI	GCGC	2 cut(s)	9, 873
Kzo9I	GATC	8 cut(s)	183, 211, 267, 553, 826, 859, 913, 985
LmnI	GCTCC	4 cut(s)	65, 163, 177, 730
Lsp1109I	GCAGC	1 cut(s)	178
LweI	GCATC	6 cut(s)	100, 257, 664, 700, 768, 952
MaeI	CTAG	4 cut(s)	132, 260, 525, 840
MaeII	ACGT	1 cut(s)	534
MaeIII	GTNAC	2 cut(s)	157, 831
MalI	GATC	8 cut(s)	185, 213, 269, 555, 828, 861, 915, 987
MboI	GATC	8 cut(s)	183, 211, 267, 553, 826, 859, 913, 985
MboII	GAAGA	3 cut(s)	56, 62, 72
MflI	RGATCY	2 cut(s)	211, 826
MhlI	GDGCHC	1 cut(s)	342
MluCI	AATT	3 cut(s)	85, 429, 666
MlyI	GAGTC	1 cut(s)	808
MseI	TTAA	1 cut(s)	350
MslI	CAYNNNNRTG	1 cut(s)	375
MspA1I	CMGCKG	1 cut(s)	169
MspR9I	CCNGG	2 cut(s)	323, 444
Mva1269I	GAATGC	1 cut(s)	151
MvaI	CCWGG	2 cut(s)	323, 444
MvnI	CGCG	1 cut(s)	873
NcoI	CCATGG	1 cut(s)	356
NdeII	GATC	8 cut(s)	183, 211, 267, 553, 826, 859, 913, 985
NlaIII	CATG	5 cut(s)	311, 360, 553, 806, 920
NlaIV	GGNNCC	1 cut(s)	61
NmuCI	GTSAC	2 cut(s)	157, 831
OliI	CACNNNNGTG	1 cut(s)	375
PagI	TCATGA	1 cut(s)	916
PaqCI	CACCTGC	2 cut(s)	809, 910
PcsI	WCGNNNNNNNCGW	1 cut(s)	877
PctI	GAATGC	1 cut(s)	151
PfeI	GAWTC	6 cut(s)	195, 505, 515, 718, 922, 980
PflMI	CCANNNNNTGG	1 cut(s)	443
PfoI	TCCNGGA	1 cut(s)	442
PkrI	GCNGC	2 cut(s)	168, 1002
PleI	GAGTC	1 cut(s)	807
PpsI	GAGTC	1 cut(s)	807
Psp6I	CCWGG	2 cut(s)	321, 442
PspGI	CCWGG	2 cut(s)	321, 442
PspN4I	GGNNCC	1 cut(s)	61
PspPI	GGNCC	3 cut(s)	74, 395, 662
PstI	CTGCAG	1 cut(s)	820
PsuI	RGATCY	2 cut(s)	211, 826
RsaI	GTAC	2 cut(s)	41, 852
RsaNI	GTAC	2 cut(s)	40, 851
RseI	CAYNNNNRTG	1 cut(s)	375
SaqAI	TTAA	1 cut(s)	350
SatI	GCNGC	2 cut(s)	167, 1001
Sau3AI	GATC	8 cut(s)	183, 211, 267, 553, 826, 859, 913, 985
Sau96I	GGNCC	3 cut(s)	74, 395, 662
SchI	GAGTC	1 cut(s)	808
ScrFI	CCNGG	2 cut(s)	323, 444
SduI	GDGCHC	1 cut(s)	342
SfaNI	GCATC	6 cut(s)	100, 257, 664, 700, 768, 952
SfcI	CTRYAG	1 cut(s)	816
SinI	GGWCC	2 cut(s)	395, 662
SmiMI	CAYNNNNRTG	1 cut(s)	375
SmlI	CTYRAG	1 cut(s)	763
SmoI	CTYRAG	1 cut(s)	763
Sse9I	AATT	3 cut(s)	85, 429, 666
SsiI	CCGC	3 cut(s)	169, 590, 1000
SspI	AATATT	1 cut(s)	484
SspMI	CTAG	4 cut(s)	132, 260, 525, 840
StyD4I	CCNGG	2 cut(s)	321, 442
StyI	CCWWGG	1 cut(s)	356
TaaI	ACNGT	2 cut(s)	104, 144
TaiI	ACGT	1 cut(s)	537
TaqI	TCGA	4 cut(s)	146, 270, 741, 932
TasI	AATT	3 cut(s)	85, 429, 666
TatI	WGTACW	1 cut(s)	850
TauI	GCSGC	1 cut(s)	1003
TfiI	GAWTC	6 cut(s)	195, 505, 515, 718, 922, 980
Tru1I	TTAA	1 cut(s)	350
Tru9I	TTAA	1 cut(s)	350
TscAI	CASTG	4 cut(s)	377, 709, 720, 976
TseFI	GTSAC	2 cut(s)	157, 831
TseI	GCWGC	1 cut(s)	166
Tsp45I	GTSAC	2 cut(s)	157, 831
TspDTI	ATGAA	3 cut(s)	78, 324, 471
TspGWI	ACGGA	2 cut(s)	176, 675
TspRI	CASTG	4 cut(s)	377, 709, 720, 976
Van91I	CCANNNNNTGG	1 cut(s)	443
VpaK11BI	GGWCC	2 cut(s)	395, 662
XmiI	GTMKAC	1 cut(s)	640
XspI	CTAG	4 cut(s)	132, 260, 525, 840

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.