Rmu_sc0004444.1_g000003

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004444.1
Physical Location & Seq
Reverse (-)
11610 .. 17082
5473 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004444.1_g000003.1.cds

Sequence Viewer

Length: 660 bp
atgggtgggatggcgaggagctgcgtacaatcaattctaaagttggtgaactcggtgaatgggatggttgggctggccatggttttgtactcgttgtggttgattagagcctggcacaagagcatggctgacttgccatttgaagactctgattatccaacaatcccttggttcatatacatttttcttggccttggggttactctgtgtgtgatcacatgttcaggacatattgctgcagacactgcaaatggttgttgcctttatttgtacatgctgtttgtctttttactcctcatgcttgaaactggagtgactgctgatatatatttaaaccatgactgggaagaggactttcctgatgatccaactgggagatttgatcaattcaaagcatttgtaaggtcaaacttggacatctgcaaatggattggcatgtcagttatatgcgtacagggacttacattgttattggcaatgatactcaaagcttttgggccacatcattattatgatagtgatgatgataatgttcctgagagggtttcacttctgaatcaccccaatccttatgtcgttggcgaccctatttatggttccaaaaatgatgcttggcatataaggatcaacagcaaggtaaaattgttaaaaaccttttag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

219

Amino Acids

24.74

Weight (kDa)

5.36

Isoelectric Point (pI)

37.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 359, 632
AcoI YGGCCR 1 cut(s) 75
AfaI GTAC 4 cut(s) 27, 89, 272, 453
AfiI CCNNNNNNNGG 2 cut(s) 343, 593
AflIII ACRYGT 1 cut(s) 218
AgsI TTSAA 3 cut(s) 143, 305, 391
AjnI CCWGG 1 cut(s) 110
AluBI AGCT 2 cut(s) 21, 491
AluI AGCT 2 cut(s) 21, 491
AlwI GGATC 2 cut(s) 359, 632
AlwNI CAGNNNCTG 1 cut(s) 245
AoxI GGCC 3 cut(s) 75, 190, 497
ApeKI GCWGC 2 cut(s) 21, 236
ArsI GACNNNNNNTTYG 2 cut(s) 122, 154
AspS9I GGNCC 1 cut(s) 497
AsuHPI GGTGA 3 cut(s) 58, 67, 551
BalI TGGCCA 1 cut(s) 77
BbsI GAAGAC 1 cut(s) 150
BbvI GCAGC 2 cut(s) 8, 223
BccI CCATC 2 cut(s) 4, 58
BciT130I CCWGG 1 cut(s) 112
BclI TGATCA 2 cut(s) 213, 382
BfmI CTRYAG 1 cut(s) 237
BisI GCNGC 2 cut(s) 22, 237
BlsI GCNGC 2 cut(s) 23, 238
Bme1390I CCNGG 1 cut(s) 112
BmgT120I GGNCC 1 cut(s) 497
BmiI GGNNCC 1 cut(s) 598
BmrFI CCNGG 1 cut(s) 112
BmrI ACTGGG 2 cut(s) 352, 381
BmsI GCATC 1 cut(s) 598
BmuI ACTGGG 2 cut(s) 352, 381
BpiI GAAGAC 1 cut(s) 150
BpmI CTGGAG 1 cut(s) 330
BsaJI CCNNGG 3 cut(s) 78, 167, 193
Bsc4I CCNNNNNNNGG 2 cut(s) 343, 593
Bse1I ACTGG 3 cut(s) 313, 347, 376
Bse3DI GCAATG 1 cut(s) 483
BseBI CCWGG 1 cut(s) 112
BseDI CCNNGG 3 cut(s) 78, 167, 193
BseGI GGATG 2 cut(s) 15, 69
BseLI CCNNNNNNNGG 2 cut(s) 343, 593
BseMI GCAATG 1 cut(s) 483
BseMII CTCAG 1 cut(s) 528
BseNI ACTGG 3 cut(s) 313, 347, 376
BseRI GAGGAG 2 cut(s) 31, 284
BseXI GCAGC 2 cut(s) 8, 223
BshFI GGCC 3 cut(s) 77, 192, 499
BslFI GGGAC 1 cut(s) 471
BslI CCNNNNNNNGG 2 cut(s) 343, 593
BsmFI GGGAC 1 cut(s) 471
BsnI GGCC 3 cut(s) 77, 192, 499
Bsp1407I TGTACA 1 cut(s) 270
Bsp143I GATC 4 cut(s) 213, 364, 382, 624
Bsp19I CCATGG 1 cut(s) 78
BspANI GGCC 3 cut(s) 77, 192, 499
BspCNI CTCAG 1 cut(s) 529
BspLI GGNNCC 1 cut(s) 598
BspMAI CTGCAG 1 cut(s) 241
BspPI GGATC 2 cut(s) 359, 632
BsrDI GCAATG 1 cut(s) 483
BsrGI TGTACA 1 cut(s) 270
BsrI ACTGG 3 cut(s) 313, 347, 376
BssECI CCNNGG 3 cut(s) 78, 167, 193
BssMI GATC 4 cut(s) 213, 364, 382, 624
BssT1I CCWWGG 3 cut(s) 78, 167, 193
Bst2UI CCWGG 1 cut(s) 112
Bst6I CTCTTC 1 cut(s) 342
BstAPI GCANNNNNTGC 1 cut(s) 245
BstAUI TGTACA 1 cut(s) 270
BstC8I GCNNGC 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 537
BstDSI CCRYGG 1 cut(s) 78
BstF5I GGATG 2 cut(s) 15, 69
BstKTI GATC 4 cut(s) 216, 367, 385, 627
BstMBI GATC 4 cut(s) 213, 364, 382, 624
BstMWI GCNNNNNNNGC 1 cut(s) 245
BstNI CCWGG 1 cut(s) 112
BstNSI RCATGY 3 cut(s) 222, 277, 439
BstSCI CCNGG 1 cut(s) 110
BstSFI CTRYAG 1 cut(s) 237
BstV1I GCAGC 2 cut(s) 8, 223
BstV2I GAAGAC 1 cut(s) 150
BsuRI GGCC 3 cut(s) 77, 192, 499
BtgI CCRYGG 1 cut(s) 78
BtsCI GGATG 2 cut(s) 15, 69
BtsI GCAGTG 1 cut(s) 243
BtsIMutI CAGTG 1 cut(s) 243
Cac8I GCNNGC 1 cut(s) 75
CaiI CAGNNNCTG 1 cut(s) 245
Cfr13I GGNCC 1 cut(s) 497
Csp6I GTAC 4 cut(s) 26, 88, 271, 452
CviAII CATG 7 cut(s) 79, 124, 219, 274, 298, 338, 436
CviJI RGCY 8 cut(s) 21, 73, 77, 110, 128, 192, 491, 499
CviKI_1 RGCY 8 cut(s) 21, 73, 77, 110, 128, 192, 491, 499
CviQI GTAC 4 cut(s) 26, 88, 271, 452
DdeI CTNAG 1 cut(s) 537
DpnI GATC 4 cut(s) 215, 366, 384, 626
DpnII GATC 4 cut(s) 213, 364, 382, 624
DraI TTTAAA 1 cut(s) 333
EaeI YGGCCR 1 cut(s) 75
Eam1104I CTCTTC 1 cut(s) 342
EarI CTCTTC 1 cut(s) 342
Eco130I CCWWGG 3 cut(s) 78, 167, 193
EcoRII CCWGG 1 cut(s) 110
EcoT14I CCWWGG 3 cut(s) 78, 167, 193
ErhI CCWWGG 3 cut(s) 78, 167, 193
FaeI CATG 7 cut(s) 82, 127, 222, 277, 301, 341, 439
FaqI GGGAC 1 cut(s) 471
FatI CATG 7 cut(s) 78, 123, 218, 273, 297, 337, 435
FbaI TGATCA 2 cut(s) 213, 382
Fnu4HI GCNGC 2 cut(s) 22, 237
FokI GGATG 2 cut(s) 22, 76
Fsp4HI GCNGC 2 cut(s) 22, 237
GluI GCNGC 2 cut(s) 22, 237
GsuI CTGGAG 1 cut(s) 330
HaeIII GGCC 3 cut(s) 77, 192, 499
Hin1II CATG 7 cut(s) 82, 127, 222, 277, 301, 341, 439
HindIII AAGCTT 1 cut(s) 489
HinfI GANTC 2 cut(s) 146, 556
HphI GGTGA 3 cut(s) 58, 67, 551
Hpy166II GTNNAC 1 cut(s) 49
Hpy188I TCNGA 2 cut(s) 151, 555
Hpy188III TCNNGA 3 cut(s) 225, 359, 536
Hpy8I GTNNAC 1 cut(s) 49
HpyCH4V TGCA 3 cut(s) 239, 248, 423
HpyF10VI GCNNNNNNNGC 1 cut(s) 245
HpyF3I CTNAG 1 cut(s) 537
Hsp92II CATG 7 cut(s) 82, 127, 222, 277, 301, 341, 439
Ksp22I TGATCA 2 cut(s) 213, 382
Kzo9I GATC 4 cut(s) 213, 364, 382, 624
LmnI GCTCC 1 cut(s) 18
Lsp1109I GCAGC 2 cut(s) 8, 223
LweI GCATC 1 cut(s) 598
MaeIII GTNAC 2 cut(s) 199, 313
MalI GATC 4 cut(s) 215, 366, 384, 626
MboI GATC 4 cut(s) 213, 364, 382, 624
MboII GAAGA 2 cut(s) 155, 359
MlsI TGGCCA 1 cut(s) 77
MluCI AATT 3 cut(s) 33, 386, 641
MluNI TGGCCA 1 cut(s) 77
MlyI GAGTC 1 cut(s) 140
MmeI TCCRAC 2 cut(s) 182, 392
MnlI CCTC 4 cut(s) 9, 305, 343, 534
Mox20I TGGCCA 1 cut(s) 77
MscI TGGCCA 1 cut(s) 77
MseI TTAA 2 cut(s) 332, 647
MslI CAYNNNNRTG 1 cut(s) 510
Msp20I TGGCCA 1 cut(s) 77
MspR9I CCNGG 1 cut(s) 112
MvaI CCWGG 1 cut(s) 112
MwoI GCNNNNNNNGC 1 cut(s) 245
NcoI CCATGG 1 cut(s) 78
NdeII GATC 4 cut(s) 213, 364, 382, 624
NlaIII CATG 7 cut(s) 82, 127, 222, 277, 301, 341, 439
NlaIV GGNNCC 1 cut(s) 598
NmuCI GTSAC 1 cut(s) 313
NspI RCATGY 3 cut(s) 222, 277, 439
PciI ACATGT 1 cut(s) 218
PfeI GAWTC 1 cut(s) 556
PkrI GCNGC 2 cut(s) 23, 238
PleI GAGTC 1 cut(s) 140
PpsI GAGTC 1 cut(s) 140
PscI ACATGT 1 cut(s) 218
Psp6I CCWGG 1 cut(s) 110
PspGI CCWGG 1 cut(s) 110
PspN4I GGNNCC 1 cut(s) 598
PspPI GGNCC 1 cut(s) 497
PstI CTGCAG 1 cut(s) 241
PstNI CAGNNNCTG 1 cut(s) 245
RsaI GTAC 4 cut(s) 27, 89, 272, 453
RsaNI GTAC 4 cut(s) 26, 88, 271, 452
RseI CAYNNNNRTG 1 cut(s) 510
SaqAI TTAA 2 cut(s) 332, 647
SatI GCNGC 2 cut(s) 22, 237
Sau3AI GATC 4 cut(s) 213, 364, 382, 624
Sau96I GGNCC 1 cut(s) 497
SchI GAGTC 1 cut(s) 140
ScrFI CCNGG 1 cut(s) 112
SetI ASST 5 cut(s) 23, 407, 493, 639, 656
SfaNI GCATC 1 cut(s) 598
SfcI CTRYAG 1 cut(s) 237
SmiMI CAYNNNNRTG 1 cut(s) 510
Sse9I AATT 3 cut(s) 33, 386, 641
StyD4I CCNGG 1 cut(s) 110
StyI CCWWGG 3 cut(s) 78, 167, 193
TasI AATT 3 cut(s) 33, 386, 641
TatI WGTACW 2 cut(s) 87, 270
TfiI GAWTC 1 cut(s) 556
Tru1I TTAA 2 cut(s) 332, 647
Tru9I TTAA 2 cut(s) 332, 647
TscAI CASTG 1 cut(s) 250
TseFI GTSAC 1 cut(s) 313
TseI GCWGC 2 cut(s) 21, 236
Tsp45I GTSAC 1 cut(s) 313
TspDTI ATGAA 1 cut(s) 163
TspRI CASTG 1 cut(s) 250
XceI RCATGY 3 cut(s) 222, 277, 439
XcmI CCANNNNNNNNNTGG 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.