Rroxscaffold_2G00117380

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
45131277 .. 45136123
4847 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00117380.1

Sequence Viewer

Length: 375 bp
ATGCTGTTTGTCTTTTTACTCCTCATGCTTGAAATTGCAGTGACTGCTGATATATATTTAAACCATGACTGGGAAGAGGACTTTCCTGATGATCCAACTGGGAGCTTTGATCAATTCAAAGCATTTGTAGGGTCAAACTTGGACATCTGCAAATGGATTGGCATGTCAGTTATATGCGTACAGGGACTTACATTGTTATTGGCAATGATACTCAAAGCTTTTGGGCCACATCATTATTATGATAGTGATGATGATTATGTTCCTGAGAGGGTTTCACTTCTGAATCACCCCAATCCTTATGTCGTTGGCGACCCTATTTATGGTTCCAAAAATGATGCTTGGCATATAAGGATCAACAGCAAGACAAACAGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

124

Amino Acids

14.19

Weight (kDa)

4.65

Isoelectric Point (pI)

29.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 86, 359
AfaI GTAC 1 cut(s) 180
AfiI CCNNNNNNNGG 2 cut(s) 70, 320
AgsI TTSAA 2 cut(s) 32, 118
AluBI AGCT 2 cut(s) 105, 218
AluI AGCT 2 cut(s) 105, 218
AlwI GGATC 2 cut(s) 86, 359
AlwNI CAGNNNCTG 1 cut(s) 44
AoxI GGCC 1 cut(s) 224
AspS9I GGNCC 1 cut(s) 224
AsuHPI GGTGA 1 cut(s) 278
BclI TGATCA 1 cut(s) 109
BmgT120I GGNCC 1 cut(s) 224
BmiI GGNNCC 1 cut(s) 325
BmrI ACTGGG 2 cut(s) 79, 108
BmsI GCATC 1 cut(s) 325
BmuI ACTGGG 2 cut(s) 79, 108
Bsc4I CCNNNNNNNGG 2 cut(s) 70, 320
Bse1I ACTGG 2 cut(s) 74, 103
Bse3DI GCAATG 1 cut(s) 210
BseLI CCNNNNNNNGG 2 cut(s) 70, 320
BseMI GCAATG 1 cut(s) 210
BseMII CTCAG 1 cut(s) 255
BseNI ACTGG 2 cut(s) 74, 103
BseRI GAGGAG 1 cut(s) 11
BshFI GGCC 1 cut(s) 226
BslFI GGGAC 1 cut(s) 198
BslI CCNNNNNNNGG 2 cut(s) 70, 320
BsmFI GGGAC 1 cut(s) 198
BsnI GGCC 1 cut(s) 226
Bsp143I GATC 3 cut(s) 91, 109, 351
BspANI GGCC 1 cut(s) 226
BspCNI CTCAG 1 cut(s) 256
BspLI GGNNCC 1 cut(s) 325
BspPI GGATC 2 cut(s) 86, 359
BsrDI GCAATG 1 cut(s) 210
BsrI ACTGG 2 cut(s) 74, 103
BssMI GATC 3 cut(s) 91, 109, 351
Bst6I CTCTTC 1 cut(s) 69
BstAPI GCANNNNNTGC 1 cut(s) 44
BstDEI CTNAG 1 cut(s) 264
BstKTI GATC 3 cut(s) 94, 112, 354
BstMBI GATC 3 cut(s) 91, 109, 351
BstMWI GCNNNNNNNGC 1 cut(s) 44
BstNSI RCATGY 1 cut(s) 166
BsuRI GGCC 1 cut(s) 226
BtsI GCAGTG 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 45
CaiI CAGNNNCTG 1 cut(s) 44
Cfr13I GGNCC 1 cut(s) 224
Csp6I GTAC 1 cut(s) 179
CviAII CATG 3 cut(s) 25, 65, 163
CviJI RGCY 3 cut(s) 105, 218, 226
CviKI_1 RGCY 3 cut(s) 105, 218, 226
CviQI GTAC 1 cut(s) 179
DdeI CTNAG 1 cut(s) 264
DpnI GATC 3 cut(s) 93, 111, 353
DpnII GATC 3 cut(s) 91, 109, 351
DraI TTTAAA 1 cut(s) 60
Eam1104I CTCTTC 1 cut(s) 69
EarI CTCTTC 1 cut(s) 69
FaeI CATG 3 cut(s) 28, 68, 166
FaqI GGGAC 1 cut(s) 198
FatI CATG 3 cut(s) 24, 64, 162
FbaI TGATCA 1 cut(s) 109
HaeIII GGCC 1 cut(s) 226
Hin1II CATG 3 cut(s) 28, 68, 166
HindIII AAGCTT 1 cut(s) 216
HinfI GANTC 1 cut(s) 283
HphI GGTGA 1 cut(s) 278
Hpy188I TCNGA 1 cut(s) 282
Hpy188III TCNNGA 2 cut(s) 86, 263
HpyCH4V TGCA 2 cut(s) 38, 150
HpyF10VI GCNNNNNNNGC 1 cut(s) 44
HpyF3I CTNAG 1 cut(s) 264
Hsp92II CATG 3 cut(s) 28, 68, 166
Ksp22I TGATCA 1 cut(s) 109
Kzo9I GATC 3 cut(s) 91, 109, 351
LmnI GCTCC 1 cut(s) 102
LpnPI CCDG 6 cut(s) 55, 84, 99, 167, 276, 355
LweI GCATC 1 cut(s) 325
MaeIII GTNAC 1 cut(s) 40
MalI GATC 3 cut(s) 93, 111, 353
MboI GATC 3 cut(s) 91, 109, 351
MboII GAAGA 1 cut(s) 86
MluCI AATT 2 cut(s) 33, 113
MmeI TCCRAC 1 cut(s) 119
MnlI CCTC 3 cut(s) 32, 70, 261
MseI TTAA 1 cut(s) 59
MslI CAYNNNNRTG 1 cut(s) 237
MwoI GCNNNNNNNGC 1 cut(s) 44
NdeII GATC 3 cut(s) 91, 109, 351
NlaIII CATG 3 cut(s) 28, 68, 166
NlaIV GGNNCC 1 cut(s) 325
NmuCI GTSAC 1 cut(s) 40
NspI RCATGY 1 cut(s) 166
PfeI GAWTC 1 cut(s) 283
PspN4I GGNNCC 1 cut(s) 325
PspPI GGNCC 1 cut(s) 224
PstNI CAGNNNCTG 1 cut(s) 44
RsaI GTAC 1 cut(s) 180
RsaNI GTAC 1 cut(s) 179
RseI CAYNNNNRTG 1 cut(s) 237
SaqAI TTAA 1 cut(s) 59
Sau3AI GATC 3 cut(s) 91, 109, 351
Sau96I GGNCC 1 cut(s) 224
SetI ASST 3 cut(s) 107, 220, 374
SfaNI GCATC 1 cut(s) 325
SmiMI CAYNNNNRTG 1 cut(s) 237
Sse9I AATT 2 cut(s) 33, 113
TasI AATT 2 cut(s) 33, 113
TfiI GAWTC 1 cut(s) 283
Tru1I TTAA 1 cut(s) 59
Tru9I TTAA 1 cut(s) 59
TscAI CASTG 1 cut(s) 45
TseFI GTSAC 1 cut(s) 40
Tsp45I GTSAC 1 cut(s) 40
TspRI CASTG 1 cut(s) 45
XceI RCATGY 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.