Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0004455.1

Orthogroup ID

OG0012348

Physical Location & Seq

Genomic Coordinates Forward (+)

18072 .. 18452

Gene Structure 381 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0004455.1_g000006.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 381 bp

atgggaaatcgacggaagggtacgactggcagaggagcggtggaggaagaggaggagaagacggcggcgaggtctggcgacctgagtgcagctgaggtgattgttagctccgaccctttgaaggttgatggcagagataagcactccagaactccactatatttagctgcacgggctgggcaaacagaagtggtgaattttctatgtaagaataaggctgatgttggtgctgctgctatggatgacatgaaagcaatacactttgctgcgcaaaagggacatttagaggagaccagtatagtagaatcacctttaatcaagaagctaactgctatagtcatagaattgtctagctctttgagtctttgtactacgacttag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Ank_2 Ank_4 Ank_5

Protein Analysis

126

Amino Acids

13.41

Weight (kDa)

6.3

Isoelectric Point (pI)

37.15

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0012348)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G19150 AT4G19150
fragaria_vesca	FvH4_5g24000
prunus_persica	Prupe.5G019900_v2.0.a1
pyrus_communis	pycom06g01270
rosa_chinensis	RchiOBHm_Chr7g0213461
rosa_laevigata	RLG00000002802 RLG00000007782
rosa_multiflora	Rmu_co8493477.1_g000002 Rmu_sc0004455.1_g000006 Rmu_sc0013012.1_g000011
rosa_roxburghii	Rroxscaffold_3G00245860
rosa_rugosa	Rorug07G0142400
rosa_samantha	Rh4BG226300 Rh7AG274500 Rh7BG270000 Rh7CG293700 Rh7DG282000
rosa_wichuraiana	Rw7G023810

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
Acc16I	TGCGCA	1 cut(s)	270
AccBSI	CCGCTC	1 cut(s)	38
AciI	CCGC	2 cut(s)	38, 65
AcsI	RAATTY	1 cut(s)	196
AfaI	GTAC	2 cut(s)	22, 370
AfiI	CCNNNNNNNGG	1 cut(s)	121
AgsI	TTSAA	1 cut(s)	121
AluBI	AGCT	5 cut(s)	92, 108, 167, 325, 354
AluI	AGCT	5 cut(s)	92, 108, 167, 325, 354
Alw26I	GTCTC	1 cut(s)	284
ApeKI	GCWGC	5 cut(s)	89, 167, 230, 233, 266
ApoI	RAATTY	1 cut(s)	196
AspLEI	GCGC	1 cut(s)	271
AsuHPI	GGTGA	3 cut(s)	109, 205, 300
BbsI	GAAGAC	1 cut(s)	65
BbvCI	CCTCAGC	1 cut(s)	93
BbvI	GCAGC	5 cut(s)	101, 154, 217, 220, 253
BccI	CCATC	1 cut(s)	122
BceAI	ACGGC	1 cut(s)	78
BcgI	CGANNNNNNTGC	2 cut(s)	68, 102
BcoDI	GTCTC	1 cut(s)	284
BfaI	CTAG	1 cut(s)	351
BfmI	CTRYAG	1 cut(s)	333
BisI	GCNGC	6 cut(s)	66, 90, 168, 231, 234, 267
BlsI	GCNGC	6 cut(s)	67, 91, 169, 232, 235, 268
BpiI	GAAGAC	1 cut(s)	65
BpmI	CTGGAG	1 cut(s)	130
Bpu10I	CCTNAGC	1 cut(s)	93
BsaI	GGTCTC	1 cut(s)	284
Bsc4I	CCNNNNNNNGG	1 cut(s)	121
Bse1I	ACTGG	2 cut(s)	31, 294
BseGI	GGATG	1 cut(s)	247
BseLI	CCNNNNNNNGG	1 cut(s)	121
BseMII	CTCAG	2 cut(s)	74, 84
BseNI	ACTGG	2 cut(s)	31, 294
BseRI	GAGGAG	4 cut(s)	48, 65, 68, 302
BseXI	GCAGC	5 cut(s)	101, 154, 217, 220, 253
BseYI	CCCAGC	1 cut(s)	176
BsgI	GTGCAG	2 cut(s)	108, 153
BslFI	GGGAC	1 cut(s)	291
BslI	CCNNNNNNNGG	1 cut(s)	121
BsmAI	GTCTC	1 cut(s)	284
BsmFI	GGGAC	1 cut(s)	291
Bso31I	GGTCTC	1 cut(s)	284
BspACI	CCGC	2 cut(s)	38, 65
BspCNI	CTCAG	2 cut(s)	75, 85
BspTNI	GGTCTC	1 cut(s)	284
BsrBI	CCGCTC	1 cut(s)	38
BsrI	ACTGG	2 cut(s)	31, 294
Bst6I	CTCTTC	1 cut(s)	42
BstDEI	CTNAG	3 cut(s)	83, 93, 378
BstF5I	GGATG	1 cut(s)	247
BstHHI	GCGC	1 cut(s)	271
BstMAI	GTCTC	1 cut(s)	284
BstMWI	GCNNNNNNNGC	1 cut(s)	173
BstSFI	CTRYAG	1 cut(s)	333
BstV1I	GCAGC	5 cut(s)	101, 154, 217, 220, 253
BstV2I	GAAGAC	1 cut(s)	65
BtsCI	GGATG	1 cut(s)	247
CfoI	GCGC	1 cut(s)	271
Csp6I	GTAC	2 cut(s)	21, 369
CviAII	CATG	1 cut(s)	247
CviJI	RGCY	7 cut(s)	92, 108, 167, 176, 218, 325, 354
CviKI_1	RGCY	7 cut(s)	92, 108, 167, 176, 218, 325, 354
CviQI	GTAC	2 cut(s)	21, 369
DdeI	CTNAG	3 cut(s)	83, 93, 378
Eam1104I	CTCTTC	1 cut(s)	42
EarI	CTCTTC	1 cut(s)	42
Eco31I	GGTCTC	1 cut(s)	284
FaeI	CATG	1 cut(s)	250
FaiI	YATR	7 cut(s)	160, 205, 239, 248, 299, 335, 341
FaqI	GGGAC	1 cut(s)	291
FatI	CATG	1 cut(s)	246
Fnu4HI	GCNGC	6 cut(s)	66, 90, 168, 231, 234, 267
FokI	GGATG	1 cut(s)	254
Fsp4HI	GCNGC	6 cut(s)	66, 90, 168, 231, 234, 267
FspBI	CTAG	1 cut(s)	351
FspI	TGCGCA	1 cut(s)	270
GlaI	GCGC	1 cut(s)	270
GluI	GCNGC	6 cut(s)	66, 90, 168, 231, 234, 267
GsaI	CCCAGC	1 cut(s)	180
GsuI	CTGGAG	1 cut(s)	130
HhaI	GCGC	1 cut(s)	271
Hin1II	CATG	1 cut(s)	250
Hin6I	GCGC	1 cut(s)	269
HinP1I	GCGC	1 cut(s)	269
HinfI	GANTC	2 cut(s)	305, 361
HphI	GGTGA	3 cut(s)	109, 205, 300
Hpy188I	TCNGA	1 cut(s)	112
Hpy188III	TCNNGA	2 cut(s)	147, 319
Hpy99I	CGWCG	1 cut(s)	15
HpyAV	CCTTC	2 cut(s)	10, 115
HpyCH4V	TGCA	2 cut(s)	89, 170
HpyF10VI	GCNNNNNNNGC	1 cut(s)	173
HpyF3I	CTNAG	3 cut(s)	83, 93, 378
Hsp92II	CATG	1 cut(s)	250
HspAI	GCGC	1 cut(s)	269
LmnI	GCTCC	2 cut(s)	35, 113
LpnPI	CCDG	6 cut(s)	12, 60, 95, 160, 162, 307
Lsp1109I	GCAGC	5 cut(s)	101, 154, 217, 220, 253
MaeI	CTAG	1 cut(s)	351
MbiI	CCGCTC	1 cut(s)	38
MboII	GAAGA	2 cut(s)	59, 70
MluCI	AATT	2 cut(s)	196, 344
MlyI	GAGTC	1 cut(s)	370
MmeI	TCCRAC	1 cut(s)	135
MnlI	CCTC	7 cut(s)	26, 37, 43, 46, 63, 88, 280
MseI	TTAA	1 cut(s)	314
MspA1I	CMGCKG	1 cut(s)	92
MwoI	GCNNNNNNNGC	1 cut(s)	173
NlaIII	CATG	1 cut(s)	250
NsbI	TGCGCA	1 cut(s)	270
PfeI	GAWTC	1 cut(s)	305
PkrI	GCNGC	6 cut(s)	67, 91, 169, 232, 235, 268
PleI	GAGTC	1 cut(s)	369
PpsI	GAGTC	1 cut(s)	369
PspFI	CCCAGC	1 cut(s)	176
PvuII	CAGCTG	1 cut(s)	92
RsaI	GTAC	2 cut(s)	22, 370
RsaNI	GTAC	2 cut(s)	21, 369
SaqAI	TTAA	1 cut(s)	314
SatI	GCNGC	6 cut(s)	66, 90, 168, 231, 234, 267
SchI	GAGTC	1 cut(s)	370
SfcI	CTRYAG	1 cut(s)	333
Sse9I	AATT	2 cut(s)	196, 344
SsiI	CCGC	2 cut(s)	38, 65
SspMI	CTAG	1 cut(s)	351
TaqI	TCGA	1 cut(s)	10
TasI	AATT	2 cut(s)	196, 344
TatI	WGTACW	1 cut(s)	368
TauI	GCSGC	1 cut(s)	68
TfiI	GAWTC	1 cut(s)	305
Tru1I	TTAA	1 cut(s)	314
Tru9I	TTAA	1 cut(s)	314
TseI	GCWGC	5 cut(s)	89, 167, 230, 233, 266
TspDTI	ATGAA	1 cut(s)	263
TspGWI	ACGGA	1 cut(s)	28
XapI	RAATTY	1 cut(s)	196
XspI	CTAG	1 cut(s)	351

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.