Rmu_sc0013012.1_g000011

Ankyrin repeats (many copies)

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013012.1
Physical Location & Seq
Forward (+)
30943 .. 31297
355 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013012.1_g000011.1.cds

Sequence Viewer

Length: 267 bp
atgggaaatcgacggaagggtacgagtggcggaggagaaacagaccttcacgcggcggcgaggtccggcgacctgagtgcagttcaggtgattgtcagctccaaccctttgaaggtcaatgggagagataagcactccagaactccgtatccttttttcccattatggttggattttgaatgtgatgatgggtatgagtctgaactgatagttaggttggtccttcatggaattaggggttttcatgggattttagctgttgggtga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

9.56

Weight (kDa)

6.9

Isoelectric Point (pI)

31.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012348)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 53
AciI CCGC 3 cut(s) 30, 53, 56
AfaI GTAC 1 cut(s) 22
AfiI CCNNNNNNNGG 2 cut(s) 52, 112
AgsI TTSAA 2 cut(s) 112, 179
AloI GAACNNNNNNTCC 2 cut(s) 133, 165
AluBI AGCT 2 cut(s) 99, 257
AluI AGCT 2 cut(s) 99, 257
AspS9I GGNCC 2 cut(s) 63, 220
AsuHPI GGTGA 1 cut(s) 100
AvaII GGWCC 2 cut(s) 63, 220
BccI CCATC 1 cut(s) 182
BcgI CGANNNNNNTGC 2 cut(s) 59, 93
BciVI GTATCC 1 cut(s) 159
BfuI GTATCC 1 cut(s) 159
BisI GCNGC 2 cut(s) 54, 57
BlsI GCNGC 2 cut(s) 55, 58
Bme18I GGWCC 2 cut(s) 63, 220
BmgT120I GGNCC 2 cut(s) 63, 220
BpmI CTGGAG 1 cut(s) 121
Bsc4I CCNNNNNNNGG 2 cut(s) 52, 112
BseLI CCNNNNNNNGG 2 cut(s) 52, 112
BseMII CTCAG 1 cut(s) 65
BseRI GAGGAG 1 cut(s) 48
BsgI GTGCAG 1 cut(s) 99
Bsh1236I CGCG 1 cut(s) 53
BsiSI CCGG 1 cut(s) 66
BslI CCNNNNNNNGG 2 cut(s) 52, 112
BspACI CCGC 3 cut(s) 30, 53, 56
BspCNI CTCAG 1 cut(s) 66
BspFNI CGCG 1 cut(s) 53
BstDEI CTNAG 1 cut(s) 74
BstFNI CGCG 1 cut(s) 53
BstUI CGCG 1 cut(s) 53
BsuI GTATCC 1 cut(s) 159
Cfr13I GGNCC 2 cut(s) 63, 220
Csp6I GTAC 1 cut(s) 21
CviAII CATG 2 cut(s) 227, 245
CviJI RGCY 2 cut(s) 99, 257
CviKI_1 RGCY 2 cut(s) 99, 257
CviQI GTAC 1 cut(s) 21
DdeI CTNAG 1 cut(s) 74
EciI GGCGGA 1 cut(s) 45
Eco47I GGWCC 2 cut(s) 63, 220
FaeI CATG 2 cut(s) 230, 248
FaiI YATR 4 cut(s) 166, 195, 228, 246
FatI CATG 2 cut(s) 226, 244
Fnu4HI GCNGC 2 cut(s) 54, 57
Fsp4HI GCNGC 2 cut(s) 54, 57
GluI GCNGC 2 cut(s) 54, 57
GsuI CTGGAG 1 cut(s) 121
HapII CCGG 1 cut(s) 66
Hin1II CATG 2 cut(s) 230, 248
HinfI GANTC 1 cut(s) 197
HpaII CCGG 1 cut(s) 66
HphI GGTGA 1 cut(s) 100
Hpy188I TCNGA 1 cut(s) 202
Hpy188III TCNNGA 1 cut(s) 138
Hpy99I CGWCG 1 cut(s) 15
HpyAV CCTTC 4 cut(s) 10, 56, 106, 233
HpyCH4V TGCA 1 cut(s) 80
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 2 cut(s) 230, 248
LmnI GCTCC 1 cut(s) 104
LpnPI CCDG 4 cut(s) 71, 79, 86, 151
MluCI AATT 1 cut(s) 231
MlyI GAGTC 1 cut(s) 206
MmeI TCCRAC 2 cut(s) 126, 150
MnlI CCTC 2 cut(s) 26, 54
MspI CCGG 1 cut(s) 66
MvnI CGCG 1 cut(s) 53
NlaIII CATG 2 cut(s) 230, 248
PkrI GCNGC 2 cut(s) 55, 58
PleI GAGTC 1 cut(s) 205
PpsI GAGTC 1 cut(s) 205
PspPI GGNCC 2 cut(s) 63, 220
RsaI GTAC 1 cut(s) 22
RsaNI GTAC 1 cut(s) 21
SatI GCNGC 2 cut(s) 54, 57
Sau96I GGNCC 2 cut(s) 63, 220
SchI GAGTC 1 cut(s) 206
SetI ASST 8 cut(s) 48, 65, 75, 90, 101, 117, 218, 259
SinI GGWCC 2 cut(s) 63, 220
Sse9I AATT 1 cut(s) 231
SsiI CCGC 3 cut(s) 30, 53, 56
TaqI TCGA 1 cut(s) 10
TasI AATT 1 cut(s) 231
TauI GCSGC 2 cut(s) 56, 59
TspDTI ATGAA 2 cut(s) 215, 233
TspGWI ACGGA 2 cut(s) 28, 135
VpaK11BI GGWCC 2 cut(s) 63, 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.