Rmu_sc0004583.1_g000012

Protein of unknown function, DUF538

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0004583.1
OG0017464
Physical Location & Seq
Forward (+)
45528 .. 45869
342 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0004583.1_g000012.1.cds

Sequence Viewer

Length: 342 bp
atgagggaaaactttcttcaatataacccctttaacccttcggagttcaaaccaaatctagatctgcaggtttctcccatcatctccctctccgtctccattcctaaacaagatctacttttttatccccttcttctaattttcgatctctctcctcttagtgttttcaatcttctgggtgactgttgcagtaaggataagatcatcacccatcacttgtcagctagggatggccgattcatcgtcgttttggagaaaccgtgctatattcagttcgagtacttggtgtactacgagagccgcatcaccagaaagctgagctacggcgcggtccgaatctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF538

Protein Analysis

113

Amino Acids

13.18

Weight (kDa)

7.7

Isoelectric Point (pI)

28.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 58
AccII CGCG 1 cut(s) 329
AciI CCGC 2 cut(s) 301, 329
AcoI YGGCCR 1 cut(s) 232
AfaI GTAC 2 cut(s) 281, 290
AgsI TTSAA 3 cut(s) 20, 49, 169
AluBI AGCT 3 cut(s) 224, 316, 321
AluI AGCT 3 cut(s) 224, 316, 321
Alw26I GTCTC 1 cut(s) 100
AoxI GGCC 1 cut(s) 232
Asp700I GAANNNNTTC 1 cut(s) 12
AspLEI GCGC 1 cut(s) 329
AspS9I GGNCC 1 cut(s) 331
AsuHPI GGTGA 3 cut(s) 191, 199, 298
AvaII GGWCC 1 cut(s) 331
BccI CCATC 3 cut(s) 86, 219, 224
BceAI ACGGC 1 cut(s) 340
BcoDI GTCTC 1 cut(s) 100
BfaI CTAG 2 cut(s) 59, 225
BfmI CTRYAG 1 cut(s) 65
BfuAI ACCTGC 1 cut(s) 58
BglII AGATCT 2 cut(s) 61, 112
BisI GCNGC 1 cut(s) 301
BlpI GCTNAGC 1 cut(s) 317
BlsI GCNGC 1 cut(s) 302
BmcAI AGTACT 1 cut(s) 281
Bme18I GGWCC 1 cut(s) 331
BmgT120I GGNCC 1 cut(s) 331
BmsI GCATC 1 cut(s) 312
Bpu1102I GCTNAGC 1 cut(s) 317
BsaXI ACNNNNNCTCC 2 cut(s) 245, 275
BseGI GGATG 1 cut(s) 235
BseMII CTCAG 1 cut(s) 308
BseRI GAGGAG 1 cut(s) 144
Bsh1236I CGCG 1 cut(s) 329
BshFI GGCC 1 cut(s) 234
BsmAI GTCTC 1 cut(s) 100
BsmBI CGTCTC 1 cut(s) 100
BsnI GGCC 1 cut(s) 234
Bsp143I GATC 4 cut(s) 61, 112, 145, 201
Bsp1720I GCTNAGC 1 cut(s) 317
BspACI CCGC 2 cut(s) 301, 329
BspANI GGCC 1 cut(s) 234
BspCNI CTCAG 1 cut(s) 309
BspFNI CGCG 1 cut(s) 329
BspMAI CTGCAG 1 cut(s) 69
BspMI ACCTGC 1 cut(s) 58
BssMI GATC 4 cut(s) 61, 112, 145, 201
Bst4CI ACNGT 2 cut(s) 185, 261
BstDEI CTNAG 2 cut(s) 158, 317
BstF5I GGATG 1 cut(s) 235
BstFNI CGCG 1 cut(s) 329
BstHHI GCGC 1 cut(s) 329
BstKTI GATC 4 cut(s) 64, 115, 148, 204
BstMAI GTCTC 1 cut(s) 100
BstMBI GATC 4 cut(s) 61, 112, 145, 201
BstSFI CTRYAG 1 cut(s) 65
BstUI CGCG 1 cut(s) 329
BstX2I RGATCY 2 cut(s) 61, 112
BstYI RGATCY 2 cut(s) 61, 112
BsuRI GGCC 1 cut(s) 234
BtsCI GGATG 1 cut(s) 235
BveI ACCTGC 1 cut(s) 58
CfoI GCGC 1 cut(s) 329
Cfr13I GGNCC 1 cut(s) 331
CpoI CGGWCCG 1 cut(s) 331
Csp6I GTAC 2 cut(s) 280, 289
CspI CGGWCCG 1 cut(s) 331
CviJI RGCY 5 cut(s) 224, 234, 300, 316, 321
CviKI_1 RGCY 5 cut(s) 224, 234, 300, 316, 321
CviQI GTAC 2 cut(s) 280, 289
DdeI CTNAG 2 cut(s) 158, 317
DpnI GATC 4 cut(s) 63, 114, 147, 203
DpnII GATC 4 cut(s) 61, 112, 145, 201
EaeI YGGCCR 1 cut(s) 232
Eco47I GGWCC 1 cut(s) 331
Esp3I CGTCTC 1 cut(s) 100
FaiI YATR 2 cut(s) 24, 267
FalI AAGNNNNNCTT 2 cut(s) 102, 134
Fnu4HI GCNGC 1 cut(s) 301
FokI GGATG 1 cut(s) 242
Fsp4HI GCNGC 1 cut(s) 301
FspBI CTAG 2 cut(s) 59, 225
GlaI GCGC 1 cut(s) 328
GluI GCNGC 1 cut(s) 301
HaeIII GGCC 1 cut(s) 234
HhaI GCGC 1 cut(s) 329
Hin6I GCGC 1 cut(s) 327
HinP1I GCGC 1 cut(s) 327
HinfI GANTC 2 cut(s) 237, 336
HphI GGTGA 3 cut(s) 191, 199, 298
Hpy166II GTNNAC 1 cut(s) 289
Hpy188I TCNGA 3 cut(s) 43, 335, 341
Hpy188III TCNNGA 1 cut(s) 59
Hpy8I GTNNAC 1 cut(s) 289
Hpy99I CGWCG 1 cut(s) 248
HpyAV CCTTC 2 cut(s) 48, 140
HpyCH4III ACNGT 2 cut(s) 185, 261
HpyCH4V TGCA 2 cut(s) 67, 189
HpyF3I CTNAG 2 cut(s) 158, 317
HspAI GCGC 1 cut(s) 327
Kzo9I GATC 4 cut(s) 61, 112, 145, 201
LpnPI CCDG 3 cut(s) 53, 161, 322
LweI GCATC 1 cut(s) 312
MaeI CTAG 2 cut(s) 59, 225
MaeIII GTNAC 1 cut(s) 179
MalI GATC 4 cut(s) 63, 114, 147, 203
MboI GATC 4 cut(s) 61, 112, 145, 201
MboII GAAGA 3 cut(s) 8, 125, 164
MflI RGATCY 2 cut(s) 61, 112
MluCI AATT 1 cut(s) 138
MnlI CCTC 2 cut(s) 98, 165
MroXI GAANNNNTTC 1 cut(s) 12
MseI TTAA 1 cut(s) 33
MvnI CGCG 1 cut(s) 329
NdeII GATC 4 cut(s) 61, 112, 145, 201
NmuCI GTSAC 1 cut(s) 179
PdmI GAANNNNTTC 1 cut(s) 12
PfeI GAWTC 2 cut(s) 237, 336
PkrI GCNGC 1 cut(s) 302
PspPI GGNCC 1 cut(s) 331
PstI CTGCAG 1 cut(s) 69
PsuI RGATCY 2 cut(s) 61, 112
RsaI GTAC 2 cut(s) 281, 290
RsaNI GTAC 2 cut(s) 280, 289
Rsr2I CGGWCCG 1 cut(s) 331
RsrII CGGWCCG 1 cut(s) 331
SaqAI TTAA 1 cut(s) 33
SatI GCNGC 1 cut(s) 301
Sau3AI GATC 4 cut(s) 61, 112, 145, 201
Sau96I GGNCC 1 cut(s) 331
ScaI AGTACT 1 cut(s) 281
SetI ASST 4 cut(s) 72, 226, 318, 323
SfaNI GCATC 1 cut(s) 312
SfcI CTRYAG 1 cut(s) 65
SinI GGWCC 1 cut(s) 331
Sse9I AATT 1 cut(s) 138
SsiI CCGC 2 cut(s) 301, 329
SspMI CTAG 2 cut(s) 59, 225
TaaI ACNGT 2 cut(s) 185, 261
TaqI TCGA 2 cut(s) 144, 276
TasI AATT 1 cut(s) 138
TatI WGTACW 2 cut(s) 279, 288
TauI GCSGC 1 cut(s) 303
TfiI GAWTC 2 cut(s) 237, 336
Tru1I TTAA 1 cut(s) 33
Tru9I TTAA 1 cut(s) 33
TseFI GTSAC 1 cut(s) 179
Tsp45I GTSAC 1 cut(s) 179
TspDTI ATGAA 1 cut(s) 229
TspGWI ACGGA 1 cut(s) 82
VpaK11BI GGWCC 1 cut(s) 331
XbaI TCTAGA 1 cut(s) 58
XmnI GAANNNNTTC 1 cut(s) 12
XspI CTAG 2 cut(s) 59, 225
ZrmI AGTACT 1 cut(s) 281
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.