Rmu_sc0005310.1_g000013

Belongs to the small heat shock protein (HSP20) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005310.1
OG0016850
Physical Location & Seq
Reverse (-)
69030 .. 69797
768 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005310.1_g000013.1.cds

Sequence Viewer

Length: 663 bp
atggatcaaagcaaggcagccggagctgatcatcaggccaaacgtacttacgaggactttgaacccttctgcaaatggcataaccgcgacaatgttgttgaggtccatattcaaggtttcagaaaggaacacctaagtgtccgtaccactcagacggggatgcttacaatccatggagaacgtccactggaccaaactaaatctacatggagccgtttccacaaagaaattaagcttccaaacaactgcgacacaaatagagttgcggcaaagtttgctgcaggagttcttacagtaacaatgcctcccaaaattgcaccacctcaacctcaatctccagaagatcagaaacaacagcttagcaatcatgaaaagttaccagaaccaagcaacaatgatactcaaacaaataatgataaagcgatagctaaattcgttaaacaaaatcaggacaagcagccaaccaccgatgaaaatgctgcattgcttgatgaagaggagacaggaagctgctgcgaattggggcaaaagagtactttagcttccaagaattggaaggtgaaactcgtgttggtggttgccgtggtggtcgcttttggtttcggggcatatatcagatacaaacacggccattactcatacagctgggagcagacagactag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HSP20

Protein Analysis

220

Amino Acids

24.92

Weight (kDa)

7.12

Isoelectric Point (pI)

42.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016850)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g18340
malus_domestica MD06G1239100.v1.1
prunus_persica Prupe.5G242900_v2.0.a1
pyrus_communis pycom06g21460
rosa_chinensis RchiOBHm_Chr7g0177251
rosa_laevigata RLG00000005551
rosa_multiflora Rmu_sc0005310.1_g000013
rosa_roxburghii Rroxscaffold_3G00276010
rosa_rugosa Rorug06G0404200
rosa_samantha Rh7AG004200 Rh7BG004000 Rh7CG003900 Rh7DG003900
rosa_wichuraiana Rw7G000340

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 552
AccII CGCG 1 cut(s) 87
AciI CCGC 2 cut(s) 85, 266
AclWI GGATC 1 cut(s) 12
AcoI YGGCCR 1 cut(s) 628
AcsI RAATTY 1 cut(s) 431
AfaI GTAC 3 cut(s) 46, 145, 535
AfiI CCNNNNNNNGG 1 cut(s) 552
AgsI TTSAA 2 cut(s) 62, 113
AjuI GAANNNNNNNTTGG 2 cut(s) 554, 586
AleI CACNNNNGTG 1 cut(s) 135
AluBI AGCT 7 cut(s) 26, 235, 358, 428, 510, 542, 645
AluI AGCT 7 cut(s) 26, 235, 358, 428, 510, 542, 645
Alw26I GTCTC 1 cut(s) 494
AlwI GGATC 1 cut(s) 12
AoxI GGCC 2 cut(s) 36, 628
ApeKI GCWGC 6 cut(s) 17, 278, 457, 479, 510, 513
ApoI RAATTY 1 cut(s) 431
AspS9I GGNCC 2 cut(s) 103, 190
AsuHPI GGTGA 1 cut(s) 571
AvaII GGWCC 2 cut(s) 103, 190
BarI GAAGNNNNNNTAC 2 cut(s) 526, 558
BauI CACGAG 1 cut(s) 566
BbvI GCAGC 6 cut(s) 29, 265, 466, 469, 497, 500
BceAI ACGGC 3 cut(s) 198, 566, 643
BcgI CGANNNNNNTGC 2 cut(s) 458, 492
BclI TGATCA 1 cut(s) 28
BcoDI GTCTC 1 cut(s) 494
BfaI CTAG 1 cut(s) 661
BfmI CTRYAG 1 cut(s) 279
BisI GCNGC 7 cut(s) 18, 267, 279, 458, 480, 511, 514
BlpI GCTNAGC 1 cut(s) 359
BlsI GCNGC 7 cut(s) 19, 268, 280, 459, 481, 512, 515
BmcAI AGTACT 1 cut(s) 535
Bme18I GGWCC 2 cut(s) 103, 190
BmgT120I GGNCC 2 cut(s) 103, 190
BmiI GGNNCC 1 cut(s) 212
BmsI GCATC 1 cut(s) 150
BpmI CTGGAG 1 cut(s) 321
Bpu1102I GCTNAGC 1 cut(s) 359
BsaJI CCNNGG 2 cut(s) 172, 582
BsaXI ACNNNNNCTCC 2 cut(s) 289, 319
Bsc4I CCNNNNNNNGG 1 cut(s) 552
Bse1I ACTGG 1 cut(s) 192
Bse3DI GCAATG 1 cut(s) 482
BseDI CCNNGG 2 cut(s) 172, 582
BseGI GGATG 1 cut(s) 165
BseLI CCNNNNNNNGG 1 cut(s) 552
BseMI GCAATG 1 cut(s) 482
BseMII CTCAG 1 cut(s) 164
BseNI ACTGG 1 cut(s) 192
BseRI GAGGAG 1 cut(s) 512
BseXI GCAGC 6 cut(s) 29, 265, 466, 469, 497, 500
BseYI CCCAGC 1 cut(s) 645
Bsh1236I CGCG 1 cut(s) 87
BshFI GGCC 2 cut(s) 38, 630
BsiSI CCGG 1 cut(s) 21
BslI CCNNNNNNNGG 1 cut(s) 552
BsmAI GTCTC 1 cut(s) 494
BsnI GGCC 2 cut(s) 38, 630
Bsp143I GATC 3 cut(s) 4, 28, 343
Bsp1720I GCTNAGC 1 cut(s) 359
Bsp19I CCATGG 1 cut(s) 172
BspACI CCGC 2 cut(s) 85, 266
BspANI GGCC 2 cut(s) 38, 630
BspCNI CTCAG 1 cut(s) 163
BspFNI CGCG 1 cut(s) 87
BspHI TCATGA 1 cut(s) 367
BspLI GGNNCC 1 cut(s) 212
BspMAI CTGCAG 1 cut(s) 283
BspPI GGATC 1 cut(s) 12
BsrDI GCAATG 1 cut(s) 482
BsrI ACTGG 1 cut(s) 192
BssECI CCNNGG 2 cut(s) 172, 582
BssMI GATC 3 cut(s) 4, 28, 343
BssSI CACGAG 1 cut(s) 566
BssT1I CCWWGG 1 cut(s) 172
Bst2BI CACGAG 1 cut(s) 566
Bst4CI ACNGT 1 cut(s) 295
Bst6I CTCTTC 1 cut(s) 489
BstAPI GCANNNNNTGC 1 cut(s) 275
BstDEI CTNAG 3 cut(s) 134, 150, 359
BstDSI CCRYGG 2 cut(s) 172, 582
BstF5I GGATG 1 cut(s) 165
BstFNI CGCG 1 cut(s) 87
BstKTI GATC 3 cut(s) 7, 31, 346
BstMAI GTCTC 1 cut(s) 494
BstMBI GATC 3 cut(s) 4, 28, 343
BstMWI GCNNNNNNNGC 2 cut(s) 23, 275
BstSFI CTRYAG 1 cut(s) 279
BstUI CGCG 1 cut(s) 87
BstV1I GCAGC 6 cut(s) 29, 265, 466, 469, 497, 500
BsuRI GGCC 2 cut(s) 38, 630
BtgI CCRYGG 2 cut(s) 172, 582
BtsCI GGATG 1 cut(s) 165
BtsIMutI CAGTG 1 cut(s) 185
CciI TCATGA 1 cut(s) 367
Cfr13I GGNCC 2 cut(s) 103, 190
Csp6I GTAC 3 cut(s) 45, 144, 534
CviAII CATG 3 cut(s) 173, 207, 368
CviQI GTAC 3 cut(s) 45, 144, 534
DdeI CTNAG 3 cut(s) 134, 150, 359
DpnI GATC 3 cut(s) 6, 30, 345
DpnII GATC 3 cut(s) 4, 28, 343
EaeI YGGCCR 1 cut(s) 628
Eam1104I CTCTTC 1 cut(s) 489
EarI CTCTTC 1 cut(s) 489
Eco130I CCWWGG 1 cut(s) 172
Eco47I GGWCC 2 cut(s) 103, 190
EcoT14I CCWWGG 1 cut(s) 172
ErhI CCWWGG 1 cut(s) 172
FaeI CATG 3 cut(s) 176, 210, 371
FaiI YATR 8 cut(s) 81, 108, 174, 208, 369, 610, 612, 640
FatI CATG 3 cut(s) 172, 206, 367
FbaI TGATCA 1 cut(s) 28
Fnu4HI GCNGC 7 cut(s) 18, 267, 279, 458, 480, 511, 514
FokI GGATG 1 cut(s) 172
Fsp4HI GCNGC 7 cut(s) 18, 267, 279, 458, 480, 511, 514
FspBI CTAG 1 cut(s) 661
GluI GCNGC 7 cut(s) 18, 267, 279, 458, 480, 511, 514
GsaI CCCAGC 1 cut(s) 649
GsuI CTGGAG 1 cut(s) 321
HaeIII GGCC 2 cut(s) 38, 630
HapII CCGG 1 cut(s) 21
Hin1II CATG 3 cut(s) 176, 210, 371
HindIII AAGCTT 1 cut(s) 233
HpaII CCGG 1 cut(s) 21
HphI GGTGA 1 cut(s) 571
Hpy166II GTNNAC 1 cut(s) 185
Hpy188I TCNGA 4 cut(s) 122, 153, 348, 617
Hpy188III TCNNGA 3 cut(s) 338, 368, 449
Hpy8I GTNNAC 1 cut(s) 185
HpyAV CCTTC 2 cut(s) 76, 550
HpyCH4III ACNGT 1 cut(s) 295
HpyCH4IV ACGT 2 cut(s) 43, 181
HpyCH4V TGCA 4 cut(s) 72, 281, 317, 482
HpyF10VI GCNNNNNNNGC 2 cut(s) 23, 275
HpyF3I CTNAG 3 cut(s) 134, 150, 359
HpySE526I ACGT 2 cut(s) 43, 181
Hsp92II CATG 3 cut(s) 176, 210, 371
Ksp22I TGATCA 1 cut(s) 28
Kzo9I GATC 3 cut(s) 4, 28, 343
LmnI GCTCC 3 cut(s) 23, 210, 649
LpnPI CCDG 9 cut(s) 20, 34, 173, 267, 351, 393, 434, 489, 631
Lsp1109I GCAGC 6 cut(s) 29, 265, 466, 469, 497, 500
LweI GCATC 1 cut(s) 150
MaeI CTAG 1 cut(s) 661
MaeII ACGT 2 cut(s) 43, 181
MaeIII GTNAC 2 cut(s) 295, 375
MalI GATC 3 cut(s) 6, 30, 345
MboI GATC 3 cut(s) 4, 28, 343
MboII GAAGA 2 cut(s) 353, 506
MluCI AATT 5 cut(s) 228, 312, 431, 518, 550
MnlI CCTC 6 cut(s) 46, 94, 315, 333, 339, 490
MseI TTAA 2 cut(s) 231, 438
MslI CAYNNNNRTG 1 cut(s) 135
MspA1I CMGCKG 1 cut(s) 645
MspI CCGG 1 cut(s) 21
MvnI CGCG 1 cut(s) 87
MwoI GCNNNNNNNGC 2 cut(s) 23, 275
NcoI CCATGG 1 cut(s) 172
NdeII GATC 3 cut(s) 4, 28, 343
NlaIII CATG 3 cut(s) 176, 210, 371
NlaIV GGNNCC 1 cut(s) 212
OliI CACNNNNGTG 1 cut(s) 135
PagI TCATGA 1 cut(s) 367
PflMI CCANNNNNTGG 1 cut(s) 552
PkrI GCNGC 7 cut(s) 19, 268, 280, 459, 481, 512, 515
PspFI CCCAGC 1 cut(s) 645
PspN4I GGNNCC 1 cut(s) 212
PspPI GGNCC 2 cut(s) 103, 190
PstI CTGCAG 1 cut(s) 283
PvuII CAGCTG 1 cut(s) 645
RsaI GTAC 3 cut(s) 46, 145, 535
RsaNI GTAC 3 cut(s) 45, 144, 534
RseI CAYNNNNRTG 1 cut(s) 135
SaqAI TTAA 2 cut(s) 231, 438
SatI GCNGC 7 cut(s) 18, 267, 279, 458, 480, 511, 514
Sau3AI GATC 3 cut(s) 4, 28, 343
Sau96I GGNCC 2 cut(s) 103, 190
ScaI AGTACT 1 cut(s) 535
SfaNI GCATC 1 cut(s) 150
SfcI CTRYAG 1 cut(s) 279
SinI GGWCC 2 cut(s) 103, 190
SmiMI CAYNNNNRTG 1 cut(s) 135
Sse9I AATT 5 cut(s) 228, 312, 431, 518, 550
SsiI CCGC 2 cut(s) 85, 266
SspMI CTAG 1 cut(s) 661
StyI CCWWGG 1 cut(s) 172
TaaI ACNGT 1 cut(s) 295
TaiI ACGT 2 cut(s) 46, 184
TasI AATT 5 cut(s) 228, 312, 431, 518, 550
TatI WGTACW 1 cut(s) 533
TauI GCSGC 1 cut(s) 269
Tru1I TTAA 2 cut(s) 231, 438
Tru9I TTAA 2 cut(s) 231, 438
TscAI CASTG 1 cut(s) 192
TseI GCWGC 6 cut(s) 17, 278, 457, 479, 510, 513
TspDTI ATGAA 3 cut(s) 384, 486, 507
TspGWI ACGGA 1 cut(s) 131
TspRI CASTG 1 cut(s) 192
Van91I CCANNNNNTGG 1 cut(s) 552
VpaK11BI GGWCC 2 cut(s) 103, 190
XapI RAATTY 1 cut(s) 431
XspI CTAG 1 cut(s) 661
ZrmI AGTACT 1 cut(s) 535
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.